Incidental Mutation 'R0736:Pde7a'
ID67282
Institutional Source Beutler Lab
Gene Symbol Pde7a
Ensembl Gene ENSMUSG00000069094
Gene Namephosphodiesterase 7A
Synonyms
MMRRC Submission 038917-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.167) question?
Stock #R0736 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location19223108-19311322 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 19231043 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 327 (N327D)
Ref Sequence ENSEMBL: ENSMUSP00000096800 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091314] [ENSMUST00000099195] [ENSMUST00000149081] [ENSMUST00000156652]
Predicted Effect possibly damaging
Transcript: ENSMUST00000091314
AA Change: N301D

PolyPhen 2 Score 0.517 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000088863
Gene: ENSMUSG00000069094
AA Change: N301D

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
HDc 183 350 2.91e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000099195
AA Change: N327D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000096800
Gene: ENSMUSG00000069094
AA Change: N327D

DomainStartEndE-ValueType
low complexity region 21 37 N/A INTRINSIC
HDc 209 376 2.91e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139426
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141455
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141621
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148590
Predicted Effect probably benign
Transcript: ENSMUST00000149081
Predicted Effect probably benign
Transcript: ENSMUST00000156652
SMART Domains Protein: ENSMUSP00000119685
Gene: ENSMUSG00000069094

DomainStartEndE-ValueType
low complexity region 21 37 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 99.0%
  • 10x: 97.6%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the cyclic nucleotide phosphodiesterase (PDE) family, and PDE7 subfamily. This PDE hydrolyzes the second messenger, cAMP, which is a regulator and mediator of a number of cellular responses to extracellular signals. Thus, by regulating the cellular concentration of cAMP, this protein plays a key role in many important physiological processes. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2011]
PHENOTYPE: Homozygous inactivation of this locus does not impair T cell function but affects the humoral immune response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik A T 5: 9,441,745 S702C probably damaging Het
Amn1 G A 6: 149,183,472 H37Y possibly damaging Het
BC027072 A G 17: 71,744,664 V1231A probably benign Het
Cacna2d3 A T 14: 29,058,628 H644Q probably benign Het
Calb1 G A 4: 15,898,917 V138M probably benign Het
Cep55 C A 19: 38,073,317 T402N probably benign Het
Chrnb3 G A 8: 27,385,050 A26T probably benign Het
Col6a3 C T 1: 90,804,089 V1481I possibly damaging Het
Dmxl2 C T 9: 54,378,817 V2695I probably damaging Het
Heatr5a A C 12: 51,896,561 probably null Het
Kmt2c C T 5: 25,295,434 M461I probably benign Het
Mapk9 G A 11: 49,883,254 D413N possibly damaging Het
Morc4 G T X: 139,854,951 Q239K probably benign Het
Myt1l T A 12: 29,827,814 V488D unknown Het
Neb A T 2: 52,192,012 Y24N probably damaging Het
Neo1 G A 9: 58,917,081 P688L possibly damaging Het
Nlrp9b A T 7: 20,049,450 D409V probably damaging Het
Pdzd8 C A 19: 59,344,933 V219L probably damaging Het
Pgc T A 17: 47,728,780 M33K probably damaging Het
Pik3ap1 T A 19: 41,332,319 T154S possibly damaging Het
Polm G C 11: 5,835,495 S188C possibly damaging Het
Slfn1 A T 11: 83,121,081 T8S probably benign Het
St8sia6 C T 2: 13,668,885 V179M probably benign Het
Tns3 A T 11: 8,519,474 F274I possibly damaging Het
Tspan5 T C 3: 138,868,398 probably null Het
Utp14b A G 1: 78,665,272 K296E probably damaging Het
Zbtb14 A G 17: 69,387,802 E165G possibly damaging Het
Zbtb17 C A 4: 141,461,786 H6N probably damaging Het
Zw10 C T 9: 49,064,132 H286Y probably benign Het
Other mutations in Pde7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01349:Pde7a APN 3 19229679 unclassified probably benign
IGL02644:Pde7a APN 3 19256867 splice site probably benign
IGL02968:Pde7a APN 3 19243121 nonsense probably null
IGL02985:Pde7a APN 3 19310883 missense probably damaging 1.00
R0081:Pde7a UTSW 3 19241533 splice site probably benign
R0834:Pde7a UTSW 3 19230318 missense probably damaging 1.00
R1499:Pde7a UTSW 3 19260244 missense possibly damaging 0.49
R1955:Pde7a UTSW 3 19227799 missense probably damaging 0.99
R2943:Pde7a UTSW 3 19230325 missense probably damaging 1.00
R4072:Pde7a UTSW 3 19256853 missense probably damaging 1.00
R4366:Pde7a UTSW 3 19310862 critical splice donor site probably null
R4524:Pde7a UTSW 3 19230976 missense possibly damaging 0.93
R4666:Pde7a UTSW 3 19260256 missense probably damaging 1.00
R4698:Pde7a UTSW 3 19310931 missense probably damaging 0.99
R4850:Pde7a UTSW 3 19243117 missense probably benign
R4859:Pde7a UTSW 3 19241491 intron probably benign
R5283:Pde7a UTSW 3 19260256 missense probably damaging 1.00
R5646:Pde7a UTSW 3 19233773 missense probably damaging 1.00
R5702:Pde7a UTSW 3 19241207 nonsense probably null
R5756:Pde7a UTSW 3 19264845 missense probably benign 0.08
R5784:Pde7a UTSW 3 19264845 missense probably benign 0.08
R6301:Pde7a UTSW 3 19243163 missense probably benign 0.01
R7136:Pde7a UTSW 3 19231094 missense probably benign 0.36
R7291:Pde7a UTSW 3 19227674 missense probably benign
Predicted Primers PCR Primer
(F):5'- AACGTGCTGTCTGTGGAACCTC -3'
(R):5'- GCATAAAGACGCTTCCTTTGGCATC -3'

Sequencing Primer
(F):5'- ACTTACCCTGAAAAAAAGATCTGC -3'
(R):5'- GCATTGTAGTATTTCCCTGAAAACTC -3'
Posted On2013-09-03