Incidental Mutation 'R0736:Pgc'
ID67308
Institutional Source Beutler Lab
Gene Symbol Pgc
Ensembl Gene ENSMUSG00000023987
Gene Nameprogastricsin (pepsinogen C)
SynonymsUpg1, 2210410L06Rik, Upg-1
MMRRC Submission 038917-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R0736 (G1)
Quality Score157
Status Not validated
Chromosome17
Chromosomal Location47726842-47734482 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 47728780 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 33 (M33K)
Ref Sequence ENSEMBL: ENSMUSP00000024782 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024782] [ENSMUST00000144955]
Predicted Effect probably damaging
Transcript: ENSMUST00000024782
AA Change: M33K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000024782
Gene: ENSMUSG00000023987
AA Change: M33K

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:A1_Propeptide 18 46 2.1e-17 PFAM
Pfam:Asp 75 391 6.3e-118 PFAM
Pfam:TAXi_N 76 232 7.2e-13 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000144955
AA Change: M33K

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000123459
Gene: ENSMUSG00000023987
AA Change: M33K

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:A1_Propeptide 18 46 1.5e-18 PFAM
Pfam:Asp 63 143 1.4e-19 PFAM
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 99.0%
  • 10x: 97.6%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an aspartic proteinase that belongs to the peptidase family A1. The encoded protein is a digestive enzyme that is produced in the stomach and constitutes a major component of the gastric mucosa. This protein is also secreted into the serum. This protein is synthesized as an inactive zymogen that includes a highly basic prosegment. This enzyme is converted into its active mature form at low pH by sequential cleavage of the prosegment that is carried out by the enzyme itself. Polymorphisms in this gene are associated with susceptibility to gastric cancers. Serum levels of this enzyme are used as a biomarker for certain gastric diseases including Helicobacter pylori related gastritis. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 1. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik A T 5: 9,441,745 S702C probably damaging Het
Amn1 G A 6: 149,183,472 H37Y possibly damaging Het
BC027072 A G 17: 71,744,664 V1231A probably benign Het
Cacna2d3 A T 14: 29,058,628 H644Q probably benign Het
Calb1 G A 4: 15,898,917 V138M probably benign Het
Cep55 C A 19: 38,073,317 T402N probably benign Het
Chrnb3 G A 8: 27,385,050 A26T probably benign Het
Col6a3 C T 1: 90,804,089 V1481I possibly damaging Het
Dmxl2 C T 9: 54,378,817 V2695I probably damaging Het
Heatr5a A C 12: 51,896,561 probably null Het
Kmt2c C T 5: 25,295,434 M461I probably benign Het
Mapk9 G A 11: 49,883,254 D413N possibly damaging Het
Morc4 G T X: 139,854,951 Q239K probably benign Het
Myt1l T A 12: 29,827,814 V488D unknown Het
Neb A T 2: 52,192,012 Y24N probably damaging Het
Neo1 G A 9: 58,917,081 P688L possibly damaging Het
Nlrp9b A T 7: 20,049,450 D409V probably damaging Het
Pde7a T C 3: 19,231,043 N327D probably damaging Het
Pdzd8 C A 19: 59,344,933 V219L probably damaging Het
Pik3ap1 T A 19: 41,332,319 T154S possibly damaging Het
Polm G C 11: 5,835,495 S188C possibly damaging Het
Slfn1 A T 11: 83,121,081 T8S probably benign Het
St8sia6 C T 2: 13,668,885 V179M probably benign Het
Tns3 A T 11: 8,519,474 F274I possibly damaging Het
Tspan5 T C 3: 138,868,398 probably null Het
Utp14b A G 1: 78,665,272 K296E probably damaging Het
Zbtb14 A G 17: 69,387,802 E165G possibly damaging Het
Zbtb17 C A 4: 141,461,786 H6N probably damaging Het
Zw10 C T 9: 49,064,132 H286Y probably benign Het
Other mutations in Pgc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01358:Pgc APN 17 47730666 missense probably benign 0.09
IGL01410:Pgc APN 17 47734240 missense probably damaging 0.98
IGL01647:Pgc APN 17 47732404 missense probably damaging 1.00
IGL02141:Pgc APN 17 47726931 missense probably damaging 1.00
IGL02719:Pgc APN 17 47728867 missense probably damaging 0.98
PIT4469001:Pgc UTSW 17 47728755 nonsense probably null
R1118:Pgc UTSW 17 47728903 critical splice donor site probably null
R1669:Pgc UTSW 17 47733790 missense probably damaging 1.00
R2162:Pgc UTSW 17 47729311 missense probably null 0.96
R3831:Pgc UTSW 17 47729311 missense probably null 0.96
R3833:Pgc UTSW 17 47729311 missense probably null 0.96
R4454:Pgc UTSW 17 47732410 missense probably benign 0.00
R4908:Pgc UTSW 17 47728894 missense probably damaging 0.96
R5544:Pgc UTSW 17 47732504 missense probably benign 0.00
R6829:Pgc UTSW 17 47732781 intron probably null
R7042:Pgc UTSW 17 47733820 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGACAATTCTCCAAGTCACCTTCCTG -3'
(R):5'- AGGCAGAAGACCTTTTGGCAGC -3'

Sequencing Primer
(F):5'- agaaagaaaaagatgaaggggaag -3'
(R):5'- ACCTTTTGGCAGCAGGGAC -3'
Posted On2013-09-03