Incidental Mutation 'R0750:Sema3a'
ID 70276
Institutional Source Beutler Lab
Gene Symbol Sema3a
Ensembl Gene ENSMUSG00000028883
Gene Name sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A
Synonyms Semad, collapsin-1, SemD, sema III, semaphorin III
MMRRC Submission 038930-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.947) question?
Stock # R0750 (G1)
Quality Score 186
Status Not validated
Chromosome 5
Chromosomal Location 13175381-13652533 bp(+) (GRCm39)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 13607092 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000128153 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030714] [ENSMUST00000095012] [ENSMUST00000137798]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000030714
SMART Domains Protein: ENSMUSP00000030714
Gene: ENSMUSG00000028883

DomainStartEndE-ValueType
Sema 57 498 4.09e-219 SMART
PSI 516 568 3.03e-12 SMART
IG 583 669 3.54e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000095012
SMART Domains Protein: ENSMUSP00000092621
Gene: ENSMUSG00000028883

DomainStartEndE-ValueType
Sema 57 498 4.09e-219 SMART
PSI 516 568 3.03e-12 SMART
IG 583 669 3.54e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000137798
SMART Domains Protein: ENSMUSP00000128153
Gene: ENSMUSG00000028883

DomainStartEndE-ValueType
Sema 57 498 4.09e-219 SMART
PSI 516 568 3.03e-12 SMART
IG 583 669 3.54e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197552
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the semaphorin family and encodes a protein with an Ig-like C2-type (immunoglobulin-like) domain, a PSI domain and a Sema domain. This secreted protein can function as either a chemorepulsive agent, inhibiting axonal outgrowth, or as a chemoattractive agent, stimulating the growth of apical dendrites. In both cases, the protein is vital for normal neuronal pattern development. Increased expression of this protein is associated with schizophrenia and is seen in a variety of human tumor cell lines. Also, aberrant release of this protein is associated with the progression of Alzheimer's disease. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit patterning abnormalities of sensory and sympathetic neurons, abnormal embryonic bones and cartilaginous structures, cardiac defects, and high postnatal mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agrn A T 4: 156,251,394 (GRCm39) L1974* probably null Het
Brd4 T C 17: 32,439,226 (GRCm39) E418G probably benign Het
Brip1 G A 11: 85,952,325 (GRCm39) S1152L possibly damaging Het
Btrc T G 19: 45,491,585 (GRCm39) F81C probably damaging Het
Cep85l A G 10: 53,157,642 (GRCm39) L585P probably damaging Het
Cfap46 T G 7: 139,234,586 (GRCm39) E671D probably damaging Het
Dsg1a T C 18: 20,473,210 (GRCm39) L761P probably benign Het
Ece2 G T 16: 20,451,800 (GRCm39) V396L probably benign Het
Garin4 G A 1: 190,896,682 (GRCm39) probably benign Het
Hs6st3 CGGAGGAGGAGGAGGAGGA CGGAGGAGGAGGAGGA 14: 119,376,119 (GRCm39) probably benign Het
Id2 A G 12: 25,145,670 (GRCm39) S114P probably damaging Het
Igf1r T C 7: 67,861,839 (GRCm39) F1133S probably damaging Het
Izumo1 T C 7: 45,275,707 (GRCm39) probably null Het
Krt35 A G 11: 99,986,979 (GRCm39) S12P possibly damaging Het
Or5a1 T C 19: 12,098,077 (GRCm39) probably null Het
Pkdrej G T 15: 85,702,275 (GRCm39) D1220E probably benign Het
Pramel32 A G 4: 88,545,905 (GRCm39) F479S probably benign Het
Tmed6 T C 8: 107,788,401 (GRCm39) Y182C possibly damaging Het
Tmem174 G T 13: 98,773,787 (GRCm39) N14K probably damaging Het
Tmem87b T C 2: 128,660,356 (GRCm39) L33P possibly damaging Het
Vmn1r16 T C 6: 57,299,812 (GRCm39) Y270C probably benign Het
Vps37d A T 5: 135,103,294 (GRCm39) L116Q possibly damaging Het
Zfp592 A G 7: 80,674,493 (GRCm39) S486G probably benign Het
Other mutations in Sema3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01022:Sema3a APN 5 13,523,433 (GRCm39) missense probably damaging 1.00
IGL01783:Sema3a APN 5 13,611,767 (GRCm39) missense probably damaging 1.00
IGL02423:Sema3a APN 5 13,615,776 (GRCm39) missense probably damaging 1.00
IGL02728:Sema3a APN 5 13,615,881 (GRCm39) missense probably damaging 1.00
IGL02739:Sema3a APN 5 13,501,128 (GRCm39) missense probably damaging 1.00
IGL02987:Sema3a APN 5 13,615,863 (GRCm39) missense probably damaging 1.00
IGL03106:Sema3a APN 5 13,649,456 (GRCm39) missense probably damaging 1.00
R0055:Sema3a UTSW 5 13,450,004 (GRCm39) missense possibly damaging 0.92
R0334:Sema3a UTSW 5 13,607,268 (GRCm39) missense probably damaging 0.99
R0684:Sema3a UTSW 5 13,606,494 (GRCm39) critical splice acceptor site probably null
R1204:Sema3a UTSW 5 13,573,142 (GRCm39) critical splice donor site probably benign
R1221:Sema3a UTSW 5 13,566,190 (GRCm39) missense probably benign
R1484:Sema3a UTSW 5 13,523,407 (GRCm39) missense probably damaging 1.00
R1663:Sema3a UTSW 5 13,607,092 (GRCm39) critical splice donor site probably null
R2079:Sema3a UTSW 5 13,501,098 (GRCm39) missense possibly damaging 0.95
R4165:Sema3a UTSW 5 13,523,364 (GRCm39) critical splice acceptor site probably null
R4596:Sema3a UTSW 5 13,620,125 (GRCm39) missense probably damaging 1.00
R4867:Sema3a UTSW 5 13,501,208 (GRCm39) missense probably benign 0.05
R4904:Sema3a UTSW 5 13,631,066 (GRCm39) missense probably damaging 1.00
R5107:Sema3a UTSW 5 13,627,572 (GRCm39) nonsense probably null
R5327:Sema3a UTSW 5 13,649,357 (GRCm39) missense probably benign 0.25
R5343:Sema3a UTSW 5 13,523,373 (GRCm39) missense probably damaging 1.00
R5430:Sema3a UTSW 5 13,615,730 (GRCm39) missense probably damaging 0.97
R5604:Sema3a UTSW 5 13,523,487 (GRCm39) critical splice donor site probably null
R5774:Sema3a UTSW 5 13,573,131 (GRCm39) missense probably damaging 1.00
R6057:Sema3a UTSW 5 13,615,832 (GRCm39) missense probably damaging 1.00
R6110:Sema3a UTSW 5 13,630,969 (GRCm39) missense probably damaging 1.00
R6132:Sema3a UTSW 5 13,573,142 (GRCm39) critical splice donor site probably null
R6310:Sema3a UTSW 5 13,606,986 (GRCm39) missense probably damaging 1.00
R6754:Sema3a UTSW 5 13,649,243 (GRCm39) missense possibly damaging 0.94
R6788:Sema3a UTSW 5 13,647,584 (GRCm39) missense possibly damaging 0.95
R6878:Sema3a UTSW 5 13,505,511 (GRCm39) missense possibly damaging 0.88
R7411:Sema3a UTSW 5 13,566,230 (GRCm39) nonsense probably null
R7501:Sema3a UTSW 5 13,607,008 (GRCm39) missense probably damaging 1.00
R7514:Sema3a UTSW 5 13,573,093 (GRCm39) missense probably benign 0.03
R7531:Sema3a UTSW 5 13,615,805 (GRCm39) missense probably damaging 1.00
R7538:Sema3a UTSW 5 13,611,787 (GRCm39) missense probably benign 0.42
R7970:Sema3a UTSW 5 13,649,375 (GRCm39) missense possibly damaging 0.93
R8121:Sema3a UTSW 5 13,649,215 (GRCm39) missense probably damaging 1.00
R8283:Sema3a UTSW 5 13,450,030 (GRCm39) missense probably damaging 0.98
R8434:Sema3a UTSW 5 13,523,487 (GRCm39) critical splice donor site probably null
R8918:Sema3a UTSW 5 13,573,099 (GRCm39) missense probably damaging 1.00
R9500:Sema3a UTSW 5 13,615,854 (GRCm39) missense possibly damaging 0.88
X0064:Sema3a UTSW 5 13,631,066 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTACACACTTGCTTATGGAACGGC -3'
(R):5'- TCAGTCTCAGTGCATGTCCACAGC -3'

Sequencing Primer
(F):5'- ACTTGCTTATGGAACGGCTTTTC -3'
(R):5'- GATGTTGTGAACACTCCATAGACG -3'
Posted On 2013-09-30