Incidental Mutation 'R0334:Sema3a'
ID26100
Institutional Source Beutler Lab
Gene Symbol Sema3a
Ensembl Gene ENSMUSG00000028883
Gene Namesema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A
SynonymsSemad, semaphorin III, SemD, sema III, collapsin-1
MMRRC Submission 038543-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.833) question?
Stock #R0334 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location13125414-13602565 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 13557301 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 321 (N321I)
Ref Sequence ENSEMBL: ENSMUSP00000092621 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030714] [ENSMUST00000095012] [ENSMUST00000137798]
Predicted Effect probably damaging
Transcript: ENSMUST00000030714
AA Change: N321I

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000030714
Gene: ENSMUSG00000028883
AA Change: N321I

DomainStartEndE-ValueType
Sema 57 498 4.09e-219 SMART
PSI 516 568 3.03e-12 SMART
IG 583 669 3.54e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000095012
AA Change: N321I

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000092621
Gene: ENSMUSG00000028883
AA Change: N321I

DomainStartEndE-ValueType
Sema 57 498 4.09e-219 SMART
PSI 516 568 3.03e-12 SMART
IG 583 669 3.54e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000137798
AA Change: N321I

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000128153
Gene: ENSMUSG00000028883
AA Change: N321I

DomainStartEndE-ValueType
Sema 57 498 4.09e-219 SMART
PSI 516 568 3.03e-12 SMART
IG 583 669 3.54e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197552
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.6%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the semaphorin family and encodes a protein with an Ig-like C2-type (immunoglobulin-like) domain, a PSI domain and a Sema domain. This secreted protein can function as either a chemorepulsive agent, inhibiting axonal outgrowth, or as a chemoattractive agent, stimulating the growth of apical dendrites. In both cases, the protein is vital for normal neuronal pattern development. Increased expression of this protein is associated with schizophrenia and is seen in a variety of human tumor cell lines. Also, aberrant release of this protein is associated with the progression of Alzheimer's disease. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit patterning abnormalities of sensory and sympathetic neurons, abnormal embryonic bones and cartilaginous structures, cardiac defects, and high postnatal mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A G 11: 23,617,129 probably benign Het
Aggf1 T C 13: 95,371,597 N87S probably benign Het
Ap2b1 T C 11: 83,367,874 probably benign Het
Arfgef3 A G 10: 18,592,281 Y1724H probably damaging Het
Arhgef10l G A 4: 140,583,926 Q243* probably null Het
Atp8a2 A T 14: 59,691,512 F1031Y probably damaging Het
Bmp8b A G 4: 123,114,760 probably null Het
Brinp2 G T 1: 158,295,585 T37K probably benign Het
Bsph1 T A 7: 13,450,939 L9* probably null Het
C6 T G 15: 4,755,367 N238K probably benign Het
Cbs T C 17: 31,619,156 D373G probably damaging Het
Clec4a3 T C 6: 122,969,370 F191S possibly damaging Het
Cpz A G 5: 35,503,681 V530A probably damaging Het
Ctsc G T 7: 88,278,342 S47I possibly damaging Het
Cyp7b1 T G 3: 18,103,796 Y53S probably damaging Het
Dach1 C T 14: 98,168,748 G188R probably damaging Het
Defb4 T C 8: 19,201,204 I29T probably benign Het
Disc1 A T 8: 125,261,097 probably null Het
Dnah2 A G 11: 69,436,836 M3429T probably damaging Het
Dnah7a A T 1: 53,433,054 I3518N possibly damaging Het
Dnah8 A T 17: 30,871,351 H4609L probably damaging Het
Evi5 C A 5: 107,820,535 C182F probably damaging Het
Fam149b G A 14: 20,363,424 R237H probably damaging Het
Fut8 T A 12: 77,393,762 D174E possibly damaging Het
Ghr T C 15: 3,341,098 probably benign Het
Gm10801 G C 2: 98,664,007 R143T possibly damaging Het
Gm12794 T C 4: 101,941,584 F251L probably benign Het
Gm8882 T A 6: 132,364,058 Q17L unknown Het
Gm9573 A G 17: 35,622,722 probably benign Het
Gpr176 T C 2: 118,279,708 S357G probably benign Het
Grwd1 A T 7: 45,827,177 probably null Het
H2-T24 A G 17: 36,014,880 V273A possibly damaging Het
Hdac4 A C 1: 91,956,038 probably benign Het
Herc3 A G 6: 58,918,817 T1017A probably damaging Het
Hsd11b1 T C 1: 193,242,168 probably benign Het
Igsf23 T C 7: 19,941,753 S143G probably benign Het
Kbtbd12 T A 6: 88,617,906 Y314F probably damaging Het
Kcnmb2 A G 3: 32,198,359 probably null Het
Kdm5b A G 1: 134,604,522 I479M probably damaging Het
Kidins220 A G 12: 25,008,069 T600A probably damaging Het
Mrgprb2 A C 7: 48,552,329 I216S probably damaging Het
Myo1g A G 11: 6,511,084 probably benign Het
Nrxn3 T C 12: 89,813,642 probably null Het
Olfr706 A G 7: 106,886,415 V134A probably benign Het
Olfr921 A T 9: 38,775,239 probably null Het
Olfr943 A G 9: 39,184,684 I169V probably benign Het
Pdia5 A T 16: 35,464,390 S66T possibly damaging Het
Plec T C 15: 76,178,006 E2604G probably damaging Het
Plekha6 G T 1: 133,282,180 A654S probably benign Het
Pnpla2 G A 7: 141,459,520 probably null Het
Prkdc A G 16: 15,736,799 D2128G probably benign Het
Rabggta A T 14: 55,720,811 L131Q probably damaging Het
Rbks A T 5: 31,624,519 Y312* probably null Het
Rnf139 A G 15: 58,899,473 Y449C probably damaging Het
Sbno1 A G 5: 124,386,868 V1058A possibly damaging Het
Slit3 T A 11: 35,579,101 V310E probably damaging Het
Slitrk5 T C 14: 111,680,824 S627P probably benign Het
Stat2 T A 10: 128,277,867 F172I probably damaging Het
Tchh C A 3: 93,445,616 R788S unknown Het
Tnks T A 8: 34,853,259 K753* probably null Het
Trank1 T A 9: 111,365,353 V815D probably benign Het
Trank1 T A 9: 111,392,940 I2915N probably damaging Het
Trpc6 T C 9: 8,610,343 S271P probably damaging Het
Trpm5 T C 7: 143,086,876 Q213R probably benign Het
Ulk3 C T 9: 57,594,227 probably benign Het
Usp31 T C 7: 121,658,962 D694G probably damaging Het
Wnt3a A G 11: 59,256,318 S181P probably damaging Het
Yipf3 T C 17: 46,248,312 F22S possibly damaging Het
Zbtb40 A T 4: 136,986,556 H1094Q probably damaging Het
Other mutations in Sema3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01022:Sema3a APN 5 13473466 missense probably damaging 1.00
IGL01783:Sema3a APN 5 13561800 missense probably damaging 1.00
IGL02423:Sema3a APN 5 13565809 missense probably damaging 1.00
IGL02728:Sema3a APN 5 13565914 missense probably damaging 1.00
IGL02739:Sema3a APN 5 13451161 missense probably damaging 1.00
IGL02987:Sema3a APN 5 13565896 missense probably damaging 1.00
IGL03106:Sema3a APN 5 13599488 missense probably damaging 1.00
R0055:Sema3a UTSW 5 13400037 missense possibly damaging 0.92
R0684:Sema3a UTSW 5 13556527 critical splice acceptor site probably null
R0750:Sema3a UTSW 5 13557125 critical splice donor site probably null
R1204:Sema3a UTSW 5 13523175 critical splice donor site probably benign
R1221:Sema3a UTSW 5 13516223 missense probably benign
R1484:Sema3a UTSW 5 13473440 missense probably damaging 1.00
R1663:Sema3a UTSW 5 13557125 critical splice donor site probably null
R2079:Sema3a UTSW 5 13451131 missense possibly damaging 0.95
R4165:Sema3a UTSW 5 13473397 critical splice acceptor site probably null
R4596:Sema3a UTSW 5 13570157 missense probably damaging 1.00
R4867:Sema3a UTSW 5 13451241 missense probably benign 0.05
R4904:Sema3a UTSW 5 13581098 missense probably damaging 1.00
R5107:Sema3a UTSW 5 13577604 nonsense probably null
R5327:Sema3a UTSW 5 13599389 missense probably benign 0.25
R5343:Sema3a UTSW 5 13473406 missense probably damaging 1.00
R5430:Sema3a UTSW 5 13565763 missense probably damaging 0.97
R5604:Sema3a UTSW 5 13473520 critical splice donor site probably null
R5774:Sema3a UTSW 5 13523164 missense probably damaging 1.00
R6057:Sema3a UTSW 5 13565865 missense probably damaging 1.00
R6110:Sema3a UTSW 5 13581001 missense probably damaging 1.00
R6132:Sema3a UTSW 5 13523175 critical splice donor site probably null
R6310:Sema3a UTSW 5 13557019 missense probably damaging 1.00
R6754:Sema3a UTSW 5 13599275 missense possibly damaging 0.94
R6788:Sema3a UTSW 5 13597616 missense possibly damaging 0.95
R6878:Sema3a UTSW 5 13455544 missense possibly damaging 0.88
X0064:Sema3a UTSW 5 13581098 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTACACACTTGCTTATGGAACGGC -3'
(R):5'- ATCAGTCTCAGTGCATGTCCACAGC -3'

Sequencing Primer
(F):5'- TAAAAGCACGCCTGATTTGCTC -3'
(R):5'- TGTCCACAGCAGGTAGTCAC -3'
Posted On2013-04-16