Incidental Mutation 'R0967:Cndp1'
ID83928
Institutional Source Beutler Lab
Gene Symbol Cndp1
Ensembl Gene ENSMUSG00000056162
Gene Namecarnosine dipeptidase 1 (metallopeptidase M20 family)
SynonymsCn1
MMRRC Submission 039096-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R0967 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location84610509-84650084 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 84634652 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000069699 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070139]
Predicted Effect probably benign
Transcript: ENSMUST00000070139
SMART Domains Protein: ENSMUSP00000069699
Gene: ENSMUSG00000056162

DomainStartEndE-ValueType
Pfam:Peptidase_M20 103 477 4.3e-33 PFAM
Pfam:M20_dimer 216 377 3.4e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130579
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145981
Meta Mutation Damage Score 0.0948 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 96.1%
  • 20x: 90.5%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the M20 metalloprotease family. The encoded protein is specifically expressed in the brain, is a homodimeric dipeptidase which was identified as human carnosinase. This gene contains trinucleotide (CTG) repeat length polymorphism in the coding region. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts19 G T 18: 58,972,740 E736* probably null Het
Atxn7l3 C G 11: 102,292,435 probably benign Het
Camk1g T C 1: 193,350,296 E269G probably damaging Het
Ccrl2 G A 9: 111,055,686 T248M probably benign Het
Chd9 T C 8: 90,989,479 S421P probably damaging Het
Csmd3 T C 15: 47,857,831 E1468G probably null Het
Cyc1 T C 15: 76,345,648 probably benign Het
Fli1 T A 9: 32,461,449 T98S probably benign Het
Gk2 T C 5: 97,456,296 S228G probably benign Het
Gse1 T A 8: 120,570,855 probably benign Het
Hgf T A 5: 16,593,841 probably benign Het
Hif1a G A 12: 73,937,670 V300I possibly damaging Het
Hsd17b4 C A 18: 50,183,261 H652N probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Kif5c T A 2: 49,698,116 probably benign Het
Lgr6 T C 1: 134,994,012 Y198C probably damaging Het
Lpcat2b T A 5: 107,434,218 M471K possibly damaging Het
Med21 A G 6: 146,650,199 E116G probably benign Het
Mos A G 4: 3,870,932 S295P probably benign Het
Ms4a15 A T 19: 10,979,321 V209E probably damaging Het
Mttp A G 3: 138,092,723 V804A probably benign Het
Olfr205 T A 16: 59,329,183 T109S possibly damaging Het
Olfr503 T C 7: 108,544,789 I86T probably damaging Het
Olfr718-ps1 A G 5: 143,137,839 M121T probably damaging Het
Plagl1 T C 10: 13,128,242 probably benign Het
Prpf8 T A 11: 75,494,430 V797E probably damaging Het
Rars2 A G 4: 34,646,587 D284G probably benign Het
Rassf8 T C 6: 145,819,950 probably benign Het
Rfx3 A G 19: 27,806,351 probably benign Het
Ripk4 A T 16: 97,744,172 M362K probably damaging Het
Rsg1 T C 4: 141,219,851 M181T probably benign Het
Rubcn C A 16: 32,825,717 E815D probably benign Het
Scn8a A G 15: 101,035,646 Y1577C probably damaging Het
Sec24b C T 3: 129,996,782 R698Q probably damaging Het
Ssc5d T A 7: 4,944,343 L1232* probably null Het
Usp7 A T 16: 8,696,654 probably benign Het
Vmn2r51 T G 7: 10,100,085 H342P probably damaging Het
Vmn2r70 A G 7: 85,559,619 M550T probably damaging Het
Vmn2r81 T C 10: 79,248,023 probably benign Het
Zc3h13 T C 14: 75,343,739 I1722T possibly damaging Het
Other mutations in Cndp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Cndp1 APN 18 84611665 missense probably benign 0.05
IGL01326:Cndp1 APN 18 84622232 missense probably benign 0.01
IGL01762:Cndp1 APN 18 84622286 missense probably damaging 1.00
IGL02061:Cndp1 APN 18 84634626 missense probably damaging 1.00
IGL02731:Cndp1 APN 18 84631958 missense probably damaging 0.99
R0098:Cndp1 UTSW 18 84628824 missense probably damaging 0.99
R0098:Cndp1 UTSW 18 84628824 missense probably damaging 0.99
R0285:Cndp1 UTSW 18 84618238 missense possibly damaging 0.72
R0494:Cndp1 UTSW 18 84619533 missense probably benign 0.01
R0968:Cndp1 UTSW 18 84634652 splice site probably benign
R0969:Cndp1 UTSW 18 84634652 splice site probably benign
R1069:Cndp1 UTSW 18 84634652 splice site probably benign
R1170:Cndp1 UTSW 18 84611625 missense probably benign 0.00
R1340:Cndp1 UTSW 18 84634652 splice site probably benign
R1414:Cndp1 UTSW 18 84634652 splice site probably benign
R1432:Cndp1 UTSW 18 84634652 splice site probably benign
R1891:Cndp1 UTSW 18 84619633 missense probably null 1.00
R3912:Cndp1 UTSW 18 84631999 missense probably benign 0.00
R4024:Cndp1 UTSW 18 84628813 missense probably damaging 1.00
R4238:Cndp1 UTSW 18 84618217 missense probably benign
R4564:Cndp1 UTSW 18 84622286 missense probably damaging 1.00
R4989:Cndp1 UTSW 18 84631900 missense probably damaging 0.99
R5015:Cndp1 UTSW 18 84631911 missense probably damaging 1.00
R5108:Cndp1 UTSW 18 84632061 missense probably damaging 1.00
R5502:Cndp1 UTSW 18 84632013 missense possibly damaging 0.56
R5835:Cndp1 UTSW 18 84612833 missense probably benign 0.00
R6396:Cndp1 UTSW 18 84632010 missense probably benign
R6549:Cndp1 UTSW 18 84636184 missense probably benign 0.04
R7251:Cndp1 UTSW 18 84622197 missense probably benign
R7465:Cndp1 UTSW 18 84619541 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGGTGCTCCGAGAACTCCGT -3'
(R):5'- TGTGTGCTTAAACTAGCTTGTCGTGT -3'

Sequencing Primer
(F):5'- GAACTCCGTCACCTCTCTCAAG -3'
(R):5'- ACACAGGTGCGGATTGTT -3'
Posted On2013-11-08