Incidental Mutation 'R1131:Gzf1'
ID94586
Institutional Source Beutler Lab
Gene Symbol Gzf1
Ensembl Gene ENSMUSG00000027439
Gene NameGDNF-inducible zinc finger protein 1
SynonymsZfp336, 8430437G08Rik
MMRRC Submission 039204-MU
Accession Numbers

Ncbi RefSeq: NM_028986.3; MGI:1921783

Is this an essential gene? Possibly essential (E-score: 0.702) question?
Stock #R1131 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location148681023-148692949 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 148690867 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 647 (N647S)
Ref Sequence ENSEMBL: ENSMUSP00000028928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028926] [ENSMUST00000028928] [ENSMUST00000136513]
Predicted Effect probably benign
Transcript: ENSMUST00000028926
SMART Domains Protein: ENSMUSP00000028926
Gene: ENSMUSG00000027438

DomainStartEndE-ValueType
Pfam:SNAP 8 288 7.3e-113 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000028928
AA Change: N647S

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000028928
Gene: ENSMUSG00000027439
AA Change: N647S

DomainStartEndE-ValueType
BTB 31 133 2.01e-20 SMART
low complexity region 199 213 N/A INTRINSIC
coiled coil region 287 308 N/A INTRINSIC
ZnF_C2H2 315 337 6.32e-3 SMART
ZnF_C2H2 346 369 1.2e-3 SMART
ZnF_C2H2 375 398 8.34e-3 SMART
ZnF_C2H2 405 427 7.78e-3 SMART
ZnF_C2H2 433 455 1.69e-3 SMART
ZnF_C2H2 461 483 1.43e-1 SMART
ZnF_C2H2 489 511 2.4e-3 SMART
ZnF_C2H2 517 539 1.47e-3 SMART
ZnF_C2H2 545 567 1.38e-3 SMART
ZnF_C2H2 573 595 1.04e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136513
SMART Domains Protein: ENSMUSP00000120979
Gene: ENSMUSG00000027438

DomainStartEndE-ValueType
Pfam:SNAP 8 114 3.5e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151362
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 91.8%
Validation Efficiency
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503B20Rik G T 3: 146,651,082 H24N probably damaging Het
Ano7 T C 1: 93,401,776 F723L probably benign Het
Clec9a T G 6: 129,410,315 C44W probably damaging Het
Commd7 T A 2: 153,622,127 Q44L probably benign Het
Ddias A T 7: 92,859,886 S274T possibly damaging Het
Fnip1 A T 11: 54,493,303 E342V possibly damaging Het
Gata4 A G 14: 63,204,740 F210S possibly damaging Het
Ggt6 A G 11: 72,435,680 E21G possibly damaging Het
Hnrnpk T C 13: 58,394,165 probably null Het
Lgr6 G A 1: 134,987,304 R569W probably damaging Het
Mug1 T A 6: 121,861,185 I458N probably benign Het
Mzf1 C A 7: 13,052,771 R124L possibly damaging Het
Olfr559 C A 7: 102,723,680 R270L probably damaging Het
Spta1 T A 1: 174,185,647 S375T probably damaging Het
Tanc2 G A 11: 105,835,002 E331K probably damaging Het
Tcirg1 A G 19: 3,896,301 S799P probably damaging Het
Tnrc18 T A 5: 142,787,208 D439V unknown Het
Tnrc6b A T 15: 80,894,453 Q1209L possibly damaging Het
Trim24 T A 6: 37,957,782 C811S probably damaging Het
Ttc7b A T 12: 100,382,119 probably null Het
Vmn1r42 A T 6: 89,845,569 F6Y possibly damaging Het
Other mutations in Gzf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01129:Gzf1 APN 2 148690996 missense probably damaging 0.99
IGL01647:Gzf1 APN 2 148683650 missense probably damaging 1.00
IGL01789:Gzf1 APN 2 148684061 missense probably benign 0.41
IGL01791:Gzf1 APN 2 148684061 missense probably benign 0.41
IGL01952:Gzf1 APN 2 148684061 missense probably benign 0.41
IGL01954:Gzf1 APN 2 148684061 missense probably benign 0.41
IGL01956:Gzf1 APN 2 148684061 missense probably benign 0.41
IGL03391:Gzf1 APN 2 148683683 missense probably damaging 1.00
I0000:Gzf1 UTSW 2 148686620 unclassified probably benign
P0019:Gzf1 UTSW 2 148683980 missense probably damaging 1.00
R0420:Gzf1 UTSW 2 148683833 missense probably benign 0.30
R0725:Gzf1 UTSW 2 148684649 nonsense probably null
R2000:Gzf1 UTSW 2 148684611 missense probably benign 0.16
R2211:Gzf1 UTSW 2 148684950 missense probably damaging 1.00
R2251:Gzf1 UTSW 2 148683936 missense probably damaging 1.00
R2252:Gzf1 UTSW 2 148683936 missense probably damaging 1.00
R2253:Gzf1 UTSW 2 148683936 missense probably damaging 1.00
R4233:Gzf1 UTSW 2 148686533 missense possibly damaging 0.86
R5551:Gzf1 UTSW 2 148684328 missense probably damaging 1.00
R6050:Gzf1 UTSW 2 148684238 missense possibly damaging 0.89
R6891:Gzf1 UTSW 2 148684769 nonsense probably null
R7457:Gzf1 UTSW 2 148690082 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TACGCCGTGGAAGTCTTTCCTTG -3'
(R):5'- TGCACAGACAACTTTTCCTCAGCC -3'

Sequencing Primer
(F):5'- TGTCATTGTAGATGGCTCACC -3'
(R):5'- GCAATTACACAGACTGCTTGG -3'
Posted On2014-01-05