Incidental Mutation 'R1015:Map3k14'
ID96186
Institutional Source Beutler Lab
Gene Symbol Map3k14
Ensembl Gene ENSMUSG00000020941
Gene Namemitogen-activated protein kinase kinase kinase 14
SynonymsNik
MMRRC Submission 039119-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.479) question?
Stock #R1015 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location103219762-103267472 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 103225300 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Histidine at position 767 (Q767H)
Ref Sequence ENSEMBL: ENSMUSP00000021324 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021324]
PDB Structure
Crystal structure of apo murine Nf-kappaB inducing kinase (NIK) [X-RAY DIFFRACTION]
Crystal structure of murine NF-kappaB inducing kinase (NIK) bound to a 6-alkynylindoline (cmp1) [X-RAY DIFFRACTION]
Crystal structure of murine NF-kappaB inducing kinase (NIK) bound to a 2-(aminothiazoly)phenol (cmp2) [X-RAY DIFFRACTION]
Crystal structure of murine NF-kappaB inducing kinase (NIK) V408L bound to a 2-(aminothiazolyl)phenol (cmp3) [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000021324
AA Change: Q767H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021324
Gene: ENSMUSG00000020941
AA Change: Q767H

DomainStartEndE-ValueType
low complexity region 134 153 N/A INTRINSIC
Pfam:Pkinase 402 653 2.1e-42 PFAM
Pfam:Pkinase_Tyr 402 653 1.5e-24 PFAM
low complexity region 706 719 N/A INTRINSIC
low complexity region 760 774 N/A INTRINSIC
low complexity region 789 804 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146163
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes mitogen-activated protein kinase kinase kinase 14, which is a serine/threonine protein-kinase. This kinase binds to TRAF2 and stimulates NF-kappaB activity. It shares sequence similarity with several other MAPKK kinases. It participates in an NF-kappaB-inducing signalling cascade common to receptors of the tumour-necrosis/nerve-growth factor (TNF/NGF) family and to the interleukin-1 type-I receptor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a spontaneous mutation exhibit deficiencies in cellular and humoral immunity, susceptibility to infections, absence of lymph nodes and Peyer's patches, failure of isotype switching, and inflammation of exocrine organs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3d1 A G 10: 80,716,489 V615A probably damaging Het
Atp6v1d A G 12: 78,849,769 V108A possibly damaging Het
AU022751 GTCATCATCATCATC GTCATCATCATCATCATC X: 6,082,591 probably benign Het
B3gnt6 C A 7: 98,194,595 V53L probably benign Het
C8b A G 4: 104,786,960 K275E probably benign Het
Cage1 T A 13: 38,016,475 N683I possibly damaging Het
Celsr3 T C 9: 108,833,176 V1535A probably benign Het
Cep120 C T 18: 53,703,121 probably null Het
Cep135 T C 5: 76,640,997 probably null Het
Chd9 T A 8: 90,932,578 H55Q probably damaging Het
Dmxl2 G A 9: 54,367,765 T2915I probably benign Het
Eps8l1 A T 7: 4,469,933 D118V probably damaging Het
Galnt2 C T 8: 124,336,617 H393Y probably benign Het
Gm8765 T G 13: 50,701,628 V434G possibly damaging Het
Gm884 T C 11: 103,545,796 H754R probably benign Het
Kdm5d T C Y: 941,687 V1296A possibly damaging Het
Kif27 T A 13: 58,320,215 K849N probably damaging Het
Kif5c T A 2: 49,744,365 D736E probably benign Het
Krt18 T C 15: 102,031,300 I311T probably benign Het
Lamc2 A T 1: 153,166,199 V63D possibly damaging Het
Lmbrd1 T A 1: 24,731,878 C295* probably null Het
Mapkapk5 T C 5: 121,533,362 K203E probably benign Het
Mcc C A 18: 44,724,669 L126F probably benign Het
Mib1 T A 18: 10,726,409 H35Q probably damaging Het
Myo16 A G 8: 10,390,183 N412D probably benign Het
Ndst2 T C 14: 20,730,064 Y36C probably damaging Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Nwd2 T C 5: 63,806,811 I1246T probably damaging Het
Olfr1034 T C 2: 86,047,082 I200T possibly damaging Het
Olfr74 T C 2: 87,974,087 T193A probably benign Het
Patl1 T C 19: 11,920,373 V108A probably benign Het
Pdzd2 T C 15: 12,374,508 E1847G probably damaging Het
Pla2g2f C T 4: 138,754,268 V57I probably benign Het
Prag1 T C 8: 36,146,543 V1083A probably damaging Het
Slc3a2 C T 19: 8,707,955 W489* probably null Het
Snx9 A G 17: 5,920,127 I379M probably benign Het
Tacc2 A G 7: 130,624,065 K846E probably benign Het
Taf4b T A 18: 14,813,098 V326E probably damaging Het
Tnrc6c C T 11: 117,721,922 S462F possibly damaging Het
Trim66 C T 7: 109,455,233 V1257I probably damaging Het
Urb2 T C 8: 124,029,434 Y627H probably damaging Het
Usp53 A G 3: 122,933,759 L1058P probably benign Het
Wdr24 A G 17: 25,828,238 S702G probably benign Het
Other mutations in Map3k14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Map3k14 APN 11 103227579 missense probably damaging 1.00
IGL00590:Map3k14 APN 11 103237554 missense probably damaging 1.00
IGL03065:Map3k14 APN 11 103225101 missense probably damaging 1.00
lucky UTSW 11 103249558 nonsense
R0020:Map3k14 UTSW 11 103227674 missense probably damaging 0.99
R0070:Map3k14 UTSW 11 103239554 critical splice acceptor site probably null
R0294:Map3k14 UTSW 11 103227137 missense possibly damaging 0.80
R0624:Map3k14 UTSW 11 103242291 missense possibly damaging 0.77
R0734:Map3k14 UTSW 11 103227000 missense probably benign 0.00
R1170:Map3k14 UTSW 11 103238917 splice site probably benign
R1487:Map3k14 UTSW 11 103225337 missense possibly damaging 0.48
R2204:Map3k14 UTSW 11 103239454 missense possibly damaging 0.82
R2880:Map3k14 UTSW 11 103221032 missense probably damaging 1.00
R4429:Map3k14 UTSW 11 103227584 missense probably damaging 1.00
R4624:Map3k14 UTSW 11 103231101 missense probably damaging 1.00
R4967:Map3k14 UTSW 11 103239531 missense probably benign 0.00
R5098:Map3k14 UTSW 11 103224359 missense probably damaging 1.00
R5148:Map3k14 UTSW 11 103239332 missense probably benign
R5208:Map3k14 UTSW 11 103239146 missense probably damaging 0.98
R5480:Map3k14 UTSW 11 103239504 missense probably benign 0.03
R6697:Map3k14 UTSW 11 103227064 missense probably benign 0.19
R6932:Map3k14 UTSW 11 103242132 missense probably damaging 1.00
T0970:Map3k14 UTSW 11 103224298 nonsense probably null
X0023:Map3k14 UTSW 11 103239822 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGATTTGTTCCTGTTCCTCCAGAGAG -3'
(R):5'- AGTGGGAGGTCTGAAAAGCCCTTG -3'

Sequencing Primer
(F):5'- TGTTCCTCCAGAGAGAACGG -3'
(R):5'- TACCTACTCCGCCGAGAGAG -3'
Posted On2014-01-05