Incidental Mutation 'R1104:Olfr784'
ID98379
Institutional Source Beutler Lab
Gene Symbol Olfr784
Ensembl Gene ENSMUSG00000094347
Gene Nameolfactory receptor 784
SynonymsGA_x6K02T2PULF-11068246-11069205, MOR110-3
MMRRC Submission 039177-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R1104 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location129384083-129390198 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 129388221 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 196 (M196K)
Ref Sequence ENSEMBL: ENSMUSP00000149354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082342] [ENSMUST00000214064]
Predicted Effect probably benign
Transcript: ENSMUST00000082342
AA Change: M196K

PolyPhen 2 Score 0.311 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000080953
Gene: ENSMUSG00000094347
AA Change: M196K

DomainStartEndE-ValueType
Pfam:7tm_4 28 306 3.3e-51 PFAM
Pfam:7tm_1 39 288 3.6e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214064
AA Change: M196K

PolyPhen 2 Score 0.311 (Sensitivity: 0.90; Specificity: 0.89)
Meta Mutation Damage Score 0.1132 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 184,033,505 S119N probably benign Het
4430402I18Rik T C 19: 28,967,632 M1V probably null Het
4930550C14Rik A G 9: 53,421,617 I93V probably benign Het
Abcg5 A C 17: 84,682,049 I77S possibly damaging Het
Adam3 T C 8: 24,681,529 Y762C probably benign Het
Agap1 T C 1: 89,789,240 S26P probably damaging Het
Ago1 T C 4: 126,453,633 Y441C probably damaging Het
B3gnt3 A G 8: 71,693,837 L16S possibly damaging Het
Btaf1 T A 19: 37,004,602 D1677E probably damaging Het
Cd5l T A 3: 87,360,899 S18T probably benign Het
Cdca2 T A 14: 67,693,682 R521W probably damaging Het
Cfap61 C A 2: 145,951,061 S64* probably null Het
Cryzl2 T A 1: 157,470,604 probably benign Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Dhrs1 T C 14: 55,743,705 K83E probably benign Het
Dmrt2 T A 19: 25,678,616 F526L probably benign Het
Dnajb14 T A 3: 137,908,354 M342K possibly damaging Het
Dpf3 A G 12: 83,331,987 V101A probably benign Het
Dthd1 A C 5: 62,821,959 T321P probably damaging Het
Flt4 C T 11: 49,636,339 probably benign Het
Fras1 G A 5: 96,708,671 R1971Q probably benign Het
Fry A G 5: 150,496,289 N608S probably damaging Het
Gabrr3 T A 16: 59,461,635 V451D probably damaging Het
Glg1 A G 8: 111,197,603 L251P probably benign Het
Gli2 T A 1: 118,853,350 S222C probably damaging Het
Gm340 G T 19: 41,586,063 G1086C probably damaging Het
Gsr A G 8: 33,669,921 E99G probably damaging Het
Hist1h1b T C 13: 21,780,281 T92A possibly damaging Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Hus1b T C 13: 30,947,696 probably benign Het
Igf1r T A 7: 68,195,026 I849N possibly damaging Het
Itih5 A G 2: 10,251,512 T930A probably benign Het
Ivns1abp T A 1: 151,360,109 M309K probably benign Het
Kdm3b T A 18: 34,819,811 F1078Y probably damaging Het
Krt12 C A 11: 99,421,966 G84V unknown Het
Krt40 T G 11: 99,540,233 E150A probably damaging Het
Lcn11 G T 2: 25,779,103 probably benign Het
Liph A G 16: 21,984,148 I57T possibly damaging Het
Lrrc46 C T 11: 97,036,171 V107M probably damaging Het
Ltb4r1 T C 14: 55,767,375 I45T probably damaging Het
Mapkbp1 A G 2: 120,011,073 probably benign Het
Mark3 C T 12: 111,618,397 probably benign Het
Mug2 C T 6: 122,059,055 A642V probably benign Het
Myh11 A G 16: 14,202,127 S1814P possibly damaging Het
Ndst1 T A 18: 60,697,146 S631C probably damaging Het
Nrbf2 A T 10: 67,267,912 D137E possibly damaging Het
Olfr630 A G 7: 103,754,976 V203A probably benign Het
Olfr698 A T 7: 106,752,782 M202K probably benign Het
Parn A G 16: 13,667,585 Y16H probably damaging Het
Parp14 A G 16: 35,844,415 probably benign Het
Prl3d1 C T 13: 27,100,009 T187I probably benign Het
Ptgir G A 7: 16,907,130 probably null Het
Rabgap1l C T 1: 160,231,875 probably benign Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Rnf213 T C 11: 119,477,229 Y4697H probably benign Het
Rps6ka4 T A 19: 6,830,996 I598F probably damaging Het
Ryr2 C T 13: 11,669,969 V3029M probably damaging Het
Slc17a2 T C 13: 23,819,937 F335S probably damaging Het
Stau2 A T 1: 16,440,361 Y124* probably null Het
Tbl3 A G 17: 24,701,606 I652T probably benign Het
Trappc3 C T 4: 126,272,966 probably benign Het
Trim60 A T 8: 65,001,419 F59L probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ush2a T C 1: 188,916,256 F4686S probably benign Het
Vcan T C 13: 89,692,410 T1672A probably damaging Het
Vmn1r215 T A 13: 23,076,588 I266N possibly damaging Het
Vmn2r6 A T 3: 64,538,066 V657E possibly damaging Het
Wdr95 G T 5: 149,606,337 A548S probably benign Het
Zfp12 A G 5: 143,245,745 Y609C probably damaging Het
Znfx1 C A 2: 167,055,640 E455* probably null Het
Other mutations in Olfr784
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02162:Olfr784 APN 10 129388104 missense probably benign 0.03
IGL03096:Olfr784 APN 10 129388449 missense probably damaging 0.96
IGL03365:Olfr784 APN 10 129388239 missense possibly damaging 0.94
R0645:Olfr784 UTSW 10 129388293 missense possibly damaging 0.88
R1456:Olfr784 UTSW 10 129387783 missense probably damaging 0.98
R1487:Olfr784 UTSW 10 129388340 missense probably benign 0.26
R1526:Olfr784 UTSW 10 129388307 missense probably benign 0.01
R1860:Olfr784 UTSW 10 129388086 missense probably damaging 1.00
R1930:Olfr784 UTSW 10 129387876 missense probably benign
R1931:Olfr784 UTSW 10 129387876 missense probably benign
R4623:Olfr784 UTSW 10 129388046 missense probably benign 0.11
R5385:Olfr784 UTSW 10 129387764 missense probably benign 0.05
R5483:Olfr784 UTSW 10 129387657 missense probably benign 0.02
R5780:Olfr784 UTSW 10 129388070 missense probably damaging 1.00
R6448:Olfr784 UTSW 10 129388152 missense probably damaging 1.00
R6956:Olfr784 UTSW 10 129388297 missense probably benign 0.04
R7102:Olfr784 UTSW 10 129388167 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCAAAGTGTGCCATCTACTGGTTC -3'
(R):5'- GTTTGAAAGCATCCTTCACCTGCTG -3'

Sequencing Primer
(F):5'- GCCATCTACTGGTTCTCAGC -3'
(R):5'- GTGTTGAGCACAGCTACACC -3'
Posted On2014-01-05