Incidental Mutation 'R1104:Mark3'
ID98389
Institutional Source Beutler Lab
Gene Symbol Mark3
Ensembl Gene ENSMUSG00000007411
Gene NameMAP/microtubule affinity regulating kinase 3
SynonymsA430080F22Rik, ETK-1, C-TAK1, 1600015G02Rik
MMRRC Submission 039177-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.299) question?
Stock #R1104 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location111574523-111656221 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 111618397 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152833 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075281] [ENSMUST00000084953] [ENSMUST00000221448] [ENSMUST00000221459] [ENSMUST00000221753] [ENSMUST00000222870]
Predicted Effect probably benign
Transcript: ENSMUST00000075281
SMART Domains Protein: ENSMUSP00000074757
Gene: ENSMUSG00000007411

DomainStartEndE-ValueType
S_TKc 56 307 7.4e-109 SMART
UBA 328 365 6.91e-9 SMART
low complexity region 368 385 N/A INTRINSIC
low complexity region 406 419 N/A INTRINSIC
Pfam:KA1 683 729 3.7e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000084953
SMART Domains Protein: ENSMUSP00000082017
Gene: ENSMUSG00000007411

DomainStartEndE-ValueType
S_TKc 56 307 7.4e-109 SMART
UBA 328 365 6.91e-9 SMART
low complexity region 368 385 N/A INTRINSIC
low complexity region 406 419 N/A INTRINSIC
Pfam:KA1 700 744 4e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220971
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221009
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221390
Predicted Effect probably benign
Transcript: ENSMUST00000221448
Predicted Effect probably benign
Transcript: ENSMUST00000221459
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221631
Predicted Effect probably benign
Transcript: ENSMUST00000221753
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222080
Predicted Effect probably benign
Transcript: ENSMUST00000222870
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is activated by phosphorylation and in turn is involved in the phosphorylation of tau proteins MAP2 and MAP4. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous disruption of this gene results in decreased body weight, increased energy expenditure, reduced adiposity, and protection from high-fat diet induced obesity. On a high-fat diet, mice show resistance to hepatic steatosis, improved glucose tolerance, and decreased insulin levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 184,033,505 S119N probably benign Het
4430402I18Rik T C 19: 28,967,632 M1V probably null Het
4930550C14Rik A G 9: 53,421,617 I93V probably benign Het
Abcg5 A C 17: 84,682,049 I77S possibly damaging Het
Adam3 T C 8: 24,681,529 Y762C probably benign Het
Agap1 T C 1: 89,789,240 S26P probably damaging Het
Ago1 T C 4: 126,453,633 Y441C probably damaging Het
B3gnt3 A G 8: 71,693,837 L16S possibly damaging Het
Btaf1 T A 19: 37,004,602 D1677E probably damaging Het
Cd5l T A 3: 87,360,899 S18T probably benign Het
Cdca2 T A 14: 67,693,682 R521W probably damaging Het
Cfap61 C A 2: 145,951,061 S64* probably null Het
Cryzl2 T A 1: 157,470,604 probably benign Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Dhrs1 T C 14: 55,743,705 K83E probably benign Het
Dmrt2 T A 19: 25,678,616 F526L probably benign Het
Dnajb14 T A 3: 137,908,354 M342K possibly damaging Het
Dpf3 A G 12: 83,331,987 V101A probably benign Het
Dthd1 A C 5: 62,821,959 T321P probably damaging Het
Flt4 C T 11: 49,636,339 probably benign Het
Fras1 G A 5: 96,708,671 R1971Q probably benign Het
Fry A G 5: 150,496,289 N608S probably damaging Het
Gabrr3 T A 16: 59,461,635 V451D probably damaging Het
Glg1 A G 8: 111,197,603 L251P probably benign Het
Gli2 T A 1: 118,853,350 S222C probably damaging Het
Gm340 G T 19: 41,586,063 G1086C probably damaging Het
Gsr A G 8: 33,669,921 E99G probably damaging Het
Hist1h1b T C 13: 21,780,281 T92A possibly damaging Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Hus1b T C 13: 30,947,696 probably benign Het
Igf1r T A 7: 68,195,026 I849N possibly damaging Het
Itih5 A G 2: 10,251,512 T930A probably benign Het
Ivns1abp T A 1: 151,360,109 M309K probably benign Het
Kdm3b T A 18: 34,819,811 F1078Y probably damaging Het
Krt12 C A 11: 99,421,966 G84V unknown Het
Krt40 T G 11: 99,540,233 E150A probably damaging Het
Lcn11 G T 2: 25,779,103 probably benign Het
Liph A G 16: 21,984,148 I57T possibly damaging Het
Lrrc46 C T 11: 97,036,171 V107M probably damaging Het
Ltb4r1 T C 14: 55,767,375 I45T probably damaging Het
Mapkbp1 A G 2: 120,011,073 probably benign Het
Mug2 C T 6: 122,059,055 A642V probably benign Het
Myh11 A G 16: 14,202,127 S1814P possibly damaging Het
Ndst1 T A 18: 60,697,146 S631C probably damaging Het
Nrbf2 A T 10: 67,267,912 D137E possibly damaging Het
Olfr630 A G 7: 103,754,976 V203A probably benign Het
Olfr698 A T 7: 106,752,782 M202K probably benign Het
Olfr784 T A 10: 129,388,221 M196K probably benign Het
Parn A G 16: 13,667,585 Y16H probably damaging Het
Parp14 A G 16: 35,844,415 probably benign Het
Prl3d1 C T 13: 27,100,009 T187I probably benign Het
Ptgir G A 7: 16,907,130 probably null Het
Rabgap1l C T 1: 160,231,875 probably benign Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Rnf213 T C 11: 119,477,229 Y4697H probably benign Het
Rps6ka4 T A 19: 6,830,996 I598F probably damaging Het
Ryr2 C T 13: 11,669,969 V3029M probably damaging Het
Slc17a2 T C 13: 23,819,937 F335S probably damaging Het
Stau2 A T 1: 16,440,361 Y124* probably null Het
Tbl3 A G 17: 24,701,606 I652T probably benign Het
Trappc3 C T 4: 126,272,966 probably benign Het
Trim60 A T 8: 65,001,419 F59L probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ush2a T C 1: 188,916,256 F4686S probably benign Het
Vcan T C 13: 89,692,410 T1672A probably damaging Het
Vmn1r215 T A 13: 23,076,588 I266N possibly damaging Het
Vmn2r6 A T 3: 64,538,066 V657E possibly damaging Het
Wdr95 G T 5: 149,606,337 A548S probably benign Het
Zfp12 A G 5: 143,245,745 Y609C probably damaging Het
Znfx1 C A 2: 167,055,640 E455* probably null Het
Other mutations in Mark3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01609:Mark3 APN 12 111627522 missense probably damaging 0.99
IGL02047:Mark3 APN 12 111618363 missense probably damaging 1.00
IGL02345:Mark3 APN 12 111627107 missense probably damaging 0.99
IGL02637:Mark3 APN 12 111592656 missense probably damaging 0.98
IGL03310:Mark3 APN 12 111647670 missense probably benign
IGL03349:Mark3 APN 12 111628250 missense probably benign 0.19
R0377:Mark3 UTSW 12 111629029 missense probably damaging 0.96
R0551:Mark3 UTSW 12 111633634 missense probably benign
R0846:Mark3 UTSW 12 111627224 missense possibly damaging 0.85
R1305:Mark3 UTSW 12 111615446 critical splice donor site probably null
R1344:Mark3 UTSW 12 111627837 missense possibly damaging 0.94
R1418:Mark3 UTSW 12 111627837 missense possibly damaging 0.94
R1434:Mark3 UTSW 12 111623325 splice site probably benign
R1556:Mark3 UTSW 12 111627841 missense probably damaging 0.98
R1569:Mark3 UTSW 12 111633746 missense probably benign 0.01
R1582:Mark3 UTSW 12 111655310 missense probably benign 0.12
R1936:Mark3 UTSW 12 111618365 missense probably damaging 0.99
R1975:Mark3 UTSW 12 111615441 missense probably damaging 1.00
R2507:Mark3 UTSW 12 111627242 missense probably damaging 1.00
R4394:Mark3 UTSW 12 111604523 missense possibly damaging 0.91
R4912:Mark3 UTSW 12 111592653 missense probably benign 0.42
R4926:Mark3 UTSW 12 111618324 nonsense probably null
R5060:Mark3 UTSW 12 111618326 missense probably damaging 0.98
R5133:Mark3 UTSW 12 111655328 missense probably damaging 1.00
R5813:Mark3 UTSW 12 111655443 missense probably damaging 1.00
R5834:Mark3 UTSW 12 111624487 missense probably damaging 0.99
R5926:Mark3 UTSW 12 111592734 missense probably damaging 1.00
R6523:Mark3 UTSW 12 111627235 missense probably damaging 1.00
R6663:Mark3 UTSW 12 111575083 missense probably benign 0.42
R6719:Mark3 UTSW 12 111615442 missense probably damaging 1.00
R6942:Mark3 UTSW 12 111592654 missense probably null 0.02
R6966:Mark3 UTSW 12 111640024 missense probably damaging 0.96
R6978:Mark3 UTSW 12 111627148 missense probably benign
R7303:Mark3 UTSW 12 111655536 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGGGCTCATTCTCAACACCCA -3'
(R):5'- CACAGGACGGACAAGGCAAGGTT -3'

Sequencing Primer
(F):5'- CCCAGAGAGAAGCTTGATGTTTATG -3'
(R):5'- AAGGTTTTGGCTCGGACCC -3'
Posted On2014-01-05