Incidental Mutation 'R1104:Mapkbp1'
ID98329
Institutional Source Beutler Lab
Gene Symbol Mapkbp1
Ensembl Gene ENSMUSG00000033902
Gene Namemitogen-activated protein kinase binding protein 1
Synonyms2810483F24Rik, Jnkbp1
MMRRC Submission 039177-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.497) question?
Stock #R1104 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location119972699-120027408 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 120011073 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066058] [ENSMUST00000229024]
Predicted Effect probably benign
Transcript: ENSMUST00000066058
SMART Domains Protein: ENSMUSP00000068516
Gene: ENSMUSG00000033902

DomainStartEndE-ValueType
WD40 80 121 8.75e-5 SMART
WD40 124 165 3.64e-2 SMART
WD40 168 205 4.62e-1 SMART
low complexity region 220 234 N/A INTRINSIC
WD40 264 301 2.65e1 SMART
WD40 332 367 1.99e0 SMART
WD40 374 422 1.29e-2 SMART
WD40 463 502 3.9e-2 SMART
WD40 505 547 2.77e-1 SMART
WD40 551 592 2.67e-1 SMART
WD40 599 639 2.21e1 SMART
WD40 642 684 5.75e-1 SMART
WD40 687 726 6.04e-8 SMART
low complexity region 736 747 N/A INTRINSIC
low complexity region 779 795 N/A INTRINSIC
low complexity region 1028 1054 N/A INTRINSIC
coiled coil region 1400 1427 N/A INTRINSIC
low complexity region 1460 1477 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128077
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137760
Predicted Effect probably benign
Transcript: ENSMUST00000229024
Meta Mutation Damage Score 0.0956 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 99% (70/71)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 184,033,505 S119N probably benign Het
4430402I18Rik T C 19: 28,967,632 M1V probably null Het
4930550C14Rik A G 9: 53,421,617 I93V probably benign Het
Abcg5 A C 17: 84,682,049 I77S possibly damaging Het
Adam3 T C 8: 24,681,529 Y762C probably benign Het
Agap1 T C 1: 89,789,240 S26P probably damaging Het
Ago1 T C 4: 126,453,633 Y441C probably damaging Het
B3gnt3 A G 8: 71,693,837 L16S possibly damaging Het
Btaf1 T A 19: 37,004,602 D1677E probably damaging Het
Cd5l T A 3: 87,360,899 S18T probably benign Het
Cdca2 T A 14: 67,693,682 R521W probably damaging Het
Cfap61 C A 2: 145,951,061 S64* probably null Het
Cryzl2 T A 1: 157,470,604 probably benign Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Dhrs1 T C 14: 55,743,705 K83E probably benign Het
Dmrt2 T A 19: 25,678,616 F526L probably benign Het
Dnajb14 T A 3: 137,908,354 M342K possibly damaging Het
Dpf3 A G 12: 83,331,987 V101A probably benign Het
Dthd1 A C 5: 62,821,959 T321P probably damaging Het
Flt4 C T 11: 49,636,339 probably benign Het
Fras1 G A 5: 96,708,671 R1971Q probably benign Het
Fry A G 5: 150,496,289 N608S probably damaging Het
Gabrr3 T A 16: 59,461,635 V451D probably damaging Het
Glg1 A G 8: 111,197,603 L251P probably benign Het
Gli2 T A 1: 118,853,350 S222C probably damaging Het
Gm340 G T 19: 41,586,063 G1086C probably damaging Het
Gsr A G 8: 33,669,921 E99G probably damaging Het
Hist1h1b T C 13: 21,780,281 T92A possibly damaging Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Hus1b T C 13: 30,947,696 probably benign Het
Igf1r T A 7: 68,195,026 I849N possibly damaging Het
Itih5 A G 2: 10,251,512 T930A probably benign Het
Ivns1abp T A 1: 151,360,109 M309K probably benign Het
Kdm3b T A 18: 34,819,811 F1078Y probably damaging Het
Krt12 C A 11: 99,421,966 G84V unknown Het
Krt40 T G 11: 99,540,233 E150A probably damaging Het
Lcn11 G T 2: 25,779,103 probably benign Het
Liph A G 16: 21,984,148 I57T possibly damaging Het
Lrrc46 C T 11: 97,036,171 V107M probably damaging Het
Ltb4r1 T C 14: 55,767,375 I45T probably damaging Het
Mark3 C T 12: 111,618,397 probably benign Het
Mug2 C T 6: 122,059,055 A642V probably benign Het
Myh11 A G 16: 14,202,127 S1814P possibly damaging Het
Ndst1 T A 18: 60,697,146 S631C probably damaging Het
Nrbf2 A T 10: 67,267,912 D137E possibly damaging Het
Olfr630 A G 7: 103,754,976 V203A probably benign Het
Olfr698 A T 7: 106,752,782 M202K probably benign Het
Olfr784 T A 10: 129,388,221 M196K probably benign Het
Parn A G 16: 13,667,585 Y16H probably damaging Het
Parp14 A G 16: 35,844,415 probably benign Het
Prl3d1 C T 13: 27,100,009 T187I probably benign Het
Ptgir G A 7: 16,907,130 probably null Het
Rabgap1l C T 1: 160,231,875 probably benign Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Rnf213 T C 11: 119,477,229 Y4697H probably benign Het
Rps6ka4 T A 19: 6,830,996 I598F probably damaging Het
Ryr2 C T 13: 11,669,969 V3029M probably damaging Het
Slc17a2 T C 13: 23,819,937 F335S probably damaging Het
Stau2 A T 1: 16,440,361 Y124* probably null Het
Tbl3 A G 17: 24,701,606 I652T probably benign Het
Trappc3 C T 4: 126,272,966 probably benign Het
Trim60 A T 8: 65,001,419 F59L probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ush2a T C 1: 188,916,256 F4686S probably benign Het
Vcan T C 13: 89,692,410 T1672A probably damaging Het
Vmn1r215 T A 13: 23,076,588 I266N possibly damaging Het
Vmn2r6 A T 3: 64,538,066 V657E possibly damaging Het
Wdr95 G T 5: 149,606,337 A548S probably benign Het
Zfp12 A G 5: 143,245,745 Y609C probably damaging Het
Znfx1 C A 2: 167,055,640 E455* probably null Het
Other mutations in Mapkbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01102:Mapkbp1 APN 2 120021858 missense possibly damaging 0.94
IGL01309:Mapkbp1 APN 2 120018942 missense probably damaging 1.00
IGL01728:Mapkbp1 APN 2 120023821 missense probably damaging 1.00
IGL01808:Mapkbp1 APN 2 120023169 unclassified probably null
IGL02185:Mapkbp1 APN 2 120014663 missense possibly damaging 0.58
IGL02421:Mapkbp1 APN 2 120019655 missense possibly damaging 0.95
IGL02691:Mapkbp1 APN 2 119973174 splice site probably benign
IGL03146:Mapkbp1 APN 2 119998474 splice site probably benign
IGL03387:Mapkbp1 APN 2 119998498 missense probably damaging 0.99
IGL03054:Mapkbp1 UTSW 2 120015400 missense probably damaging 0.97
R0118:Mapkbp1 UTSW 2 120025215 missense probably benign 0.00
R0393:Mapkbp1 UTSW 2 120012903 splice site probably null
R0463:Mapkbp1 UTSW 2 120023151 missense probably benign 0.01
R0788:Mapkbp1 UTSW 2 120024001 missense probably benign 0.02
R0928:Mapkbp1 UTSW 2 120015368 missense probably benign 0.00
R1162:Mapkbp1 UTSW 2 120025318 missense possibly damaging 0.87
R1219:Mapkbp1 UTSW 2 120019350 nonsense probably null
R1299:Mapkbp1 UTSW 2 120015404 missense probably damaging 1.00
R1300:Mapkbp1 UTSW 2 120013655 missense probably benign 0.25
R1342:Mapkbp1 UTSW 2 119998534 missense possibly damaging 0.95
R1456:Mapkbp1 UTSW 2 119973145 missense probably damaging 1.00
R1464:Mapkbp1 UTSW 2 120021261 missense probably benign
R1464:Mapkbp1 UTSW 2 120021261 missense probably benign
R1470:Mapkbp1 UTSW 2 120017820 missense probably damaging 1.00
R1470:Mapkbp1 UTSW 2 120017820 missense probably damaging 1.00
R1660:Mapkbp1 UTSW 2 120018548 missense possibly damaging 0.83
R2008:Mapkbp1 UTSW 2 120012665 missense probably damaging 1.00
R2083:Mapkbp1 UTSW 2 120015482 missense possibly damaging 0.96
R2371:Mapkbp1 UTSW 2 120010780 missense probably damaging 1.00
R2423:Mapkbp1 UTSW 2 120024590 missense probably benign 0.00
R3976:Mapkbp1 UTSW 2 120021858 missense possibly damaging 0.94
R4009:Mapkbp1 UTSW 2 120023605 missense probably benign 0.00
R4183:Mapkbp1 UTSW 2 120017865 missense probably damaging 1.00
R4246:Mapkbp1 UTSW 2 120013027 missense probably damaging 1.00
R4503:Mapkbp1 UTSW 2 120015706 missense probably damaging 1.00
R4513:Mapkbp1 UTSW 2 120023693 missense possibly damaging 0.63
R4517:Mapkbp1 UTSW 2 120025064 intron probably benign
R4742:Mapkbp1 UTSW 2 120016818 missense probably damaging 1.00
R5049:Mapkbp1 UTSW 2 120015501 splice site probably benign
R5079:Mapkbp1 UTSW 2 120013733 missense probably damaging 0.99
R5137:Mapkbp1 UTSW 2 120022181 missense probably damaging 1.00
R5255:Mapkbp1 UTSW 2 120017254 missense probably damaging 1.00
R5530:Mapkbp1 UTSW 2 120015355 missense probably benign
R5546:Mapkbp1 UTSW 2 120019243 missense probably damaging 1.00
R5634:Mapkbp1 UTSW 2 119973095 missense probably damaging 1.00
R5696:Mapkbp1 UTSW 2 120021720 splice site probably null
R5891:Mapkbp1 UTSW 2 120023932 nonsense probably null
R6263:Mapkbp1 UTSW 2 120023291 missense probably damaging 1.00
R6807:Mapkbp1 UTSW 2 120021159 missense probably damaging 0.99
R6890:Mapkbp1 UTSW 2 120015802 missense probably damaging 1.00
R7159:Mapkbp1 UTSW 2 120025132 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- ATCCTCAACAGCTCCAGGTGTGTG -3'
(R):5'- AGCATTTGACATAACCTTCATGACCCC -3'

Sequencing Primer
(F):5'- GGACGCGCATATACACTCTTG -3'
(R):5'- gcctcgaactcagaaatccac -3'
Posted On2014-01-05