Incidental Mutation 'R1024:Oog2'
ID98747
Institutional Source Beutler Lab
Gene Symbol Oog2
Ensembl Gene ENSMUSG00000066030
Gene Nameoogenesin 2
Synonyms
MMRRC Submission 039126-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R1024 (G1)
Quality Score192
Status Not validated
Chromosome4
Chromosomal Location144190719-144196934 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 144196286 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 374 (T374P)
Ref Sequence ENSEMBL: ENSMUSP00000079267 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080405] [ENSMUST00000143978]
Predicted Effect probably damaging
Transcript: ENSMUST00000080405
AA Change: T374P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000079267
Gene: ENSMUSG00000066030
AA Change: T374P

DomainStartEndE-ValueType
SCOP:d1a4ya_ 204 391 2e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129781
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141847
Predicted Effect probably benign
Transcript: ENSMUST00000143978
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.4%
  • 10x: 95.6%
  • 20x: 90.2%
Validation Efficiency 90% (36/40)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 T C 7: 75,677,409 S719P probably damaging Het
Atxn2l A T 7: 126,497,294 N425K probably benign Het
B3galt4 G A 17: 33,950,839 R142C probably damaging Het
Cacna2d2 T C 9: 107,527,050 probably null Het
Ccar2 A G 14: 70,140,515 S674P probably damaging Het
Ccm2 T A 11: 6,570,119 Y56* probably null Het
Cdc14b A T 13: 64,215,676 V257E probably damaging Het
Cdca8 A C 4: 124,922,005 S171R probably benign Het
Cep192 C T 18: 67,838,054 T1042I probably benign Het
Cfap100 T A 6: 90,413,004 T101S possibly damaging Het
Cfap46 T A 7: 139,642,597 M1155L probably benign Het
Cyp3a13 T A 5: 137,894,364 I473F possibly damaging Het
Dclk3 A G 9: 111,469,070 I561V possibly damaging Het
Dock6 A T 9: 21,833,612 L556H probably damaging Het
Dqx1 G A 6: 83,061,089 C486Y probably damaging Het
Drd1 T A 13: 54,053,314 M294L probably benign Het
Dsel A G 1: 111,860,673 S711P probably damaging Het
Fcho2 A T 13: 98,732,659 I568N probably damaging Het
Folr1 A G 7: 101,858,603 M210T probably damaging Het
Gatc T A 5: 115,340,845 probably null Het
Gja8 A T 3: 96,919,424 F307L probably benign Het
H1fnt G A 15: 98,256,755 T171I unknown Het
Hnrnpd C A 5: 99,966,157 *87L probably null Het
Hpd C T 5: 123,174,469 R279H possibly damaging Het
Igfals G A 17: 24,880,483 V183M probably damaging Het
Izumo1 A G 7: 45,627,174 Y387C probably benign Het
Kdm5a A G 6: 120,399,038 N585S probably null Het
March2 C A 17: 33,709,788 G45C probably damaging Het
Myo15 A T 11: 60,479,616 R1067S probably benign Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Nell1 A G 7: 50,120,663 S157G probably damaging Het
Nf1 A T 11: 79,547,033 E2072D probably damaging Het
Nipal1 CGGG CGG 5: 72,667,991 probably null Het
Nop2 T A 6: 125,137,186 V205E probably benign Het
Nphs1 G T 7: 30,474,277 S939I probably damaging Het
Nudt8 T A 19: 4,001,925 W179R probably damaging Het
Nutm1 A T 2: 112,249,929 I547N probably benign Het
Olfr729 A T 14: 50,147,927 F316I probably benign Het
Olfr921 C A 9: 38,775,335 L27I probably damaging Het
Otud4 T A 8: 79,664,093 M413K probably benign Het
Pear1 A G 3: 87,760,299 probably benign Het
Pla2g3 G A 11: 3,488,551 C67Y probably damaging Het
Plxdc2 A G 2: 16,712,106 T334A probably benign Het
Ppl G A 16: 5,100,000 R543W probably damaging Het
Prl5a1 G A 13: 28,149,897 V128I probably damaging Het
Pth1r T C 9: 110,729,621 D96G probably benign Het
Pth1r A T 9: 110,742,227 L25Q probably damaging Het
Rfpl4 G T 7: 5,110,518 D215E probably damaging Het
Rnf146 T A 10: 29,347,096 R265* probably null Het
Rpe65 T C 3: 159,606,485 I207T probably benign Het
Rptn A G 3: 93,398,225 E955G possibly damaging Het
Rwdd2b A T 16: 87,436,850 C121S probably damaging Het
Scn10a A G 9: 119,609,274 I1843T probably damaging Het
Sirt5 A G 13: 43,370,769 I6V probably benign Het
Slc25a36 A G 9: 97,079,201 Y261H probably damaging Het
Slc5a3 G A 16: 92,077,495 A147T probably damaging Het
Stk39 T C 2: 68,410,046 S114G probably damaging Het
Stxbp1 T C 2: 32,814,967 probably null Het
Syt3 G T 7: 44,390,682 G113V probably damaging Het
Tatdn2 A G 6: 113,709,545 T644A probably damaging Het
Trim9 T A 12: 70,252,017 probably null Het
Tut1 A G 19: 8,959,355 N181S probably benign Het
Vill T C 9: 119,066,824 S151P probably damaging Het
Vmn2r90 A T 17: 17,728,138 I549F probably damaging Het
Wdfy4 T C 14: 33,079,966 T1912A possibly damaging Het
Other mutations in Oog2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00843:Oog2 APN 4 144195172 missense probably damaging 1.00
IGL01317:Oog2 APN 4 144195267 missense probably benign 0.16
IGL01697:Oog2 APN 4 144195184 missense possibly damaging 0.90
IGL02237:Oog2 APN 4 144196446 missense possibly damaging 0.95
IGL02411:Oog2 APN 4 144195048 missense probably damaging 0.99
IGL02476:Oog2 APN 4 144195229 missense probably benign 0.02
IGL03284:Oog2 APN 4 144196607 unclassified probably benign
IGL03394:Oog2 APN 4 144194006 missense probably benign 0.17
R0538:Oog2 UTSW 4 144196084 nonsense probably null
R0892:Oog2 UTSW 4 144196499 missense probably benign 0.00
R4156:Oog2 UTSW 4 144193953 intron probably benign
R4157:Oog2 UTSW 4 144193953 intron probably benign
R4166:Oog2 UTSW 4 144194841 missense probably damaging 1.00
R4167:Oog2 UTSW 4 144196212 missense probably benign 0.18
R4732:Oog2 UTSW 4 144193941 intron probably benign
R4734:Oog2 UTSW 4 144196451 missense probably benign 0.00
R4741:Oog2 UTSW 4 144195145 missense possibly damaging 0.94
R4909:Oog2 UTSW 4 144195099 missense possibly damaging 0.78
R4954:Oog2 UTSW 4 144190732 start gained probably benign
R6437:Oog2 UTSW 4 144195108 unclassified probably null
R6487:Oog2 UTSW 4 144196485 missense possibly damaging 0.48
R6946:Oog2 UTSW 4 144196464 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGTGTCATCTGCTTGTCTGCCAATC -3'
(R):5'- ACCCACCACACTTGGAGCATTTG -3'

Sequencing Primer
(F):5'- ACAGTCAGACTTGGATTACCTC -3'
(R):5'- TATGGCCCTGAGTATATCCAGGAG -3'
Posted On2014-01-09