Phenotypic Mutation 'bananasplit' (pdf version)
List |< first << previous [record 27 of 511] next >> last >|
Allelebananasplit
Mutation Type missense
Chromosome12
Coordinate111,262,036 bp (GRCm38)
Base Change T ⇒ G (forward strand)
Gene Traf3
Gene Name TNF receptor-associated factor 3
Synonym(s) LAP1, CRAF1, CD40bp, CAP-1
Chromosomal Location 111,166,370-111,267,153 bp (+)
MGI Phenotype Homozygous mutation of this gene results in progressive runting, hypoglycemia, and depletion of peripheral white blood cells, leading to death by 10 days of age. Immune responses to T-dependent antigen are impaired in lethally irradiated mice reconstituted with mutant cells.
Accession Number

NCBI RefSeq: NM_011632, NM_001286122; MGI:108041

Mapped Yes 
Amino Acid Change Aspartic acid changed to Glutamic Acid
Institutional SourceBeutler Lab
Gene Model predicted sequence gene model
PDB Structure
Crystal structure of TRAF3/Cardif [X-RAY DIFFRACTION]
SMART Domains Protein: ENSMUSP00000021706
Gene: ENSMUSG00000021277
AA Change: D560E

DomainStartEndE-ValueType
RING 52 87 5.85e-2 SMART
Pfam:zf-TRAF 135 191 4.6e-18 PFAM
Pfam:zf-TRAF 191 250 9.9e-14 PFAM
coiled coil region 298 337 N/A INTRINSIC
MATH 419 542 5.69e-18 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
(Using ENSMUST00000021706)
SMART Domains Protein: ENSMUSP00000058361
Gene: ENSMUSG00000021277
AA Change: D535E

DomainStartEndE-ValueType
RING 52 87 5.85e-2 SMART
Pfam:zf-TRAF 135 191 1.5e-17 PFAM
coiled coil region 273 312 N/A INTRINSIC
MATH 394 517 5.69e-18 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
(Using ENSMUST00000060274)
SMART Domains Protein: ENSMUSP00000112517
Gene: ENSMUSG00000021277
AA Change: D535E

DomainStartEndE-ValueType
RING 52 87 5.85e-2 SMART
Pfam:zf-TRAF 135 191 1.5e-17 PFAM
coiled coil region 273 312 N/A INTRINSIC
MATH 394 517 5.69e-18 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
(Using ENSMUST00000117269)
Phenotypic Category T-dependent humoral response defect- decreased antibody response to rSFV
Penetrance  
Alleles Listed at MGI

All mutations/alleles(19) : Chemically induced (ENU)(1) Gene trapped(10) Targeted(8)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Traf3 APN 12 111239067 missense possibly damaging 0.47
IGL02015:Traf3 APN 12 111252740 missense probably benign 0.00
IGL02318:Traf3 APN 12 111237597 missense probably benign 0.00
IGL02429:Traf3 APN 12 111243465 missense probably benign 0.13
IGL03088:Traf3 APN 12 111261843 missense probably damaging 0.97
han UTSW 12 111261576 missense
Hulk UTSW 12 111261576 missense probably damaging 1.00
R0023:Traf3 UTSW 12 111243478 nonsense probably null
R0143:Traf3 UTSW 12 111261576 missense probably damaging 1.00
R1453:Traf3 UTSW 12 111255323 missense probably damaging 0.96
R1507:Traf3 UTSW 12 111260760 missense probably benign 0.28
R1714:Traf3 UTSW 12 111242473 missense probably benign 0.00
R1996:Traf3 UTSW 12 111260661 missense probably benign 0.21
R1997:Traf3 UTSW 12 111260661 missense probably benign 0.21
R3946:Traf3 UTSW 12 111255245 missense possibly damaging 0.91
R4477:Traf3 UTSW 12 111248602 missense probably benign 0.00
R4621:Traf3 UTSW 12 111260786 missense noncoding transcript
R4645:Traf3 UTSW 12 111261966 missense probably damaging 1.00
R4723:Traf3 UTSW 12 111262036 missense probably damaging 1.00
R4820:Traf3 UTSW 12 111260770 missense possibly damaging 0.96
R5123:Traf3 UTSW 12 111243518 missense possibly damaging 0.52
R5775:Traf3 UTSW 12 111252728 missense possibly damaging 0.91
R5912:Traf3 UTSW 12 111255349 missense probably benign 0.01
X0052:Traf3 UTSW 12 111252736 missense probably benign 0.41
Mode of Inheritance Autosomal Recessive
Local Stock Sperm
MMRRC Submission
Last Updated 03/29/2017 12:09 PM by Katherine Timer
Record Created 01/18/2015 8:55 AM by Kuan-Wen Wang
Record Posted 02/11/2015
Phenotypic Description

Figure 4. Homozygous bananasplit mice exhibited diminished T-dependent IgG responses to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal). IgG levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The bananasplit phenotype was identified among N-Nitroso-N-ethylurea (ENU)-mutagenized G3 mice of the pedigree R1651, some of which showed a reduced T-dependent antibody response to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal; Figure 1). 

Nature of Mutation

Figure 2. Linkage mapping of the reduced T-dependent IgG response to rSFV-β-gal using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 73 mutations (X-axis) identified in the G1 male of pedigree R1651.  Normalized phenotype data are shown for single locus linkage analysis with consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 73 mutations. The diminished T-dependent antibody response to rSFV-β-gal was linked by continuous variable mapping to a mutation in Traf3: a T to G transversion at base pair 111,262,036 (v38) on chromosome 12, or base pair 95,667 in the GenBank genomic region NC_000078 encoding Traf3. Linkage was found with a recessive model of inheritance (P = 7.049 x 10-8), wherein one variant homozygote mouse departed phenotypically from three homozygous reference mice and six heterozygous mice (Figure 2). The mutation corresponds to residue 2,041 in the mRNA sequence NM_011632 within exon 12 of 12 total exons.

 

2024 ATTAAGGTCATAGTGGATACCTCGGATCTGCCT

555  -I--K--V--I--V--D--T--S--D--L--P-

 

The mutated nucleotide is indicated in red.  The mutation results in an aspartic acid (D) to glutamic acid (E) substitution at position 560 (D560E) in the TRAF3 protein, and is strongly predicted by Polyphen-2 to cause loss of function (score = 1.00).

Protein Prediction

Figure 6. Domain structure of TRAF3. Please see the text for more details about the domains shown. Abbreviations: RING, really interesting new gene; ZINC, zinc finger motifs; CC, coiled coil; TRAF, TNFR-associated factor. The bananasplit mutation is a D to E substitution at position 560 (D560E). The image is interactive; click to view other mutations in TRAF3.

Traf3 encodes the ubiquitously expressed tumor necrosis factor receptor (TNFR)-associated factor 3 (TRAF3), a member of the TRAF family of intracellular adaptor proteins. Similar to the other members of the TRAF family, TRAF3 has an N-terminal really interesting new gene (RING) finger domain (amino acids 52-87, SMART), two zinc finger domains (amino acids 135-191 & 191-250, SMART), a coiled-coil domain (amino acids 298-337, SMART), and a C-terminal meprin and TRAF homology (MATH) domain (often designated simply as the TRAF domain; amino acids 419-542, SMART) [Figure 3; (1;2)]. The bananasplit mutation (D560E) is in an undefined domain near the C-terminus of the TRAF3 protein.

 

Please see the record hulk for information about Traf3.

Putative Mechanism

TRAF3 functions in several cell types including B cells, T cells, dendritic cells, macrophages, and osteoclast precursors [reviewed in (3)]. TRAF3 functions in the alternative (i.e., non-canonical) NF-κB (NF-κB2; see the record for xander) signaling pathway [(4;5); reviewed in (2)]. The NF-κB2 pathway regulates secondary lymphoid organogenesis via LTβR-associated signaling (see the record kama), thymic epithelial cell development, and iNKT cell development as well as B cell development, maintenance, and antibody production (6-9). TRAF3 is essential for T helper cell function in antigen-specific IgG responses to T cell-dependent antigens (9;10). In T cell-specific Traf3 knockout mouse (T-TRAF3-/-; CD4CreTRAF3flox/flox), the T-dependent IgG1 response to TNP-KLH was impaired at all timepoints examined (9). Similar to the hulk mice, the bananasplit mice exhibit a reduced response to rSFV-β-gal, indicating diminished TRAF3 function.

Primers PCR Primer
bananasplit(F):5'- GCCGTTCAAGCAGAAAGTGACAC -3'
bananasplit(R):5'- GCCTACTCAGGGTCTTCTGACAAAC -3'

Sequencing Primer
bananasplit_seq(F):5'- ACACTTATGCTGATGGATCAGG -3'
bananasplit_seq(R):5'- CTCGTAGGTTAACATGCTGACAC -3'
References
Science Writers Anne Murray
Illustrators Katherine Timer
AuthorsKuan-Wen Wang, Jin Huk Choi, Apiruck Watthanasurorot, Bruce Beutler
List |< first << previous [record 27 of 511] next >> last >|