Phenotypic Mutation 'Hulk' (pdf version)
AlleleHulk
Mutation Type missense
Chromosome12
Coordinate111,261,576 bp (GRCm38)
Base Change T ⇒ A (forward strand)
Gene Traf3
Gene Name TNF receptor-associated factor 3
Synonym(s) LAP1, CRAF1, CD40bp, CAP-1
Chromosomal Location 111,166,370-111,267,153 bp (+)
MGI Phenotype Homozygous mutation of this gene results in progressive runting, hypoglycemia, and depletion of peripheral white blood cells, leading to death by 10 days of age. Immune responses to T-dependent antigen are impaired in lethally irradiated mice reconstituted with mutant cells.
Accession Number

NBCI RefSeq: NM_011632, NM_001286122; MGI:108041

Mapped Yes 
Amino Acid Change Valine changed to Aspartic acid
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000021706]
PDB Structure
Crystal structure of TRAF3/Cardif [X-RAY DIFFRACTION]
SMART Domains Protein: ENSMUSP00000021706
Gene: ENSMUSG00000021277
AA Change: V407D

DomainStartEndE-ValueType
RING 52 87 5.85e-2 SMART
Pfam:zf-TRAF 135 191 4.6e-18 PFAM
Pfam:zf-TRAF 191 250 9.9e-14 PFAM
coiled coil region 298 337 N/A INTRINSIC
MATH 419 542 5.69e-18 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 1.80; Specificity: 1.00)
(Using ENSMUST00000021706)
Phenotypic Category decrease in B cells, T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization, T-dependent humoral response defect- decreased antibody response to rSFV, T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization
Penetrance  
Alleles Listed at MGI

All alleles(18) : Targeted(8) Gene trapped(10)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Traf3 APN 12 111239067 missense possibly damaging 0.47
IGL02015:Traf3 APN 12 111252740 missense probably benign 0.00
IGL02318:Traf3 APN 12 111237597 missense probably benign 0.00
IGL02429:Traf3 APN 12 111243465 missense probably benign 0.13
IGL03088:Traf3 APN 12 111261843 missense probably damaging 0.97
bananasplit UTSW 12 111262036 missense probably damaging 1.00
han UTSW 12 111261576 missense
R0023:Traf3 UTSW 12 111243478 nonsense probably null
R0143:Traf3 UTSW 12 111261576 missense probably damaging 1.00
R1453:Traf3 UTSW 12 111255323 missense probably damaging 0.96
R1507:Traf3 UTSW 12 111260760 missense probably benign 0.28
R1714:Traf3 UTSW 12 111242473 missense probably benign 0.00
R1996:Traf3 UTSW 12 111260661 missense probably benign 0.21
R1997:Traf3 UTSW 12 111260661 missense probably benign 0.21
R3946:Traf3 UTSW 12 111255245 missense possibly damaging 0.91
R4477:Traf3 UTSW 12 111248602 missense probably benign 0.00
R4621:Traf3 UTSW 12 111260786 missense noncoding transcript
R4645:Traf3 UTSW 12 111261966 missense probably damaging 1.00
R4723:Traf3 UTSW 12 111262036 missense probably damaging 1.00
R4820:Traf3 UTSW 12 111260770 missense possibly damaging 0.96
R5123:Traf3 UTSW 12 111243518 missense possibly damaging 0.52
R5775:Traf3 UTSW 12 111252728 missense possibly damaging 0.91
R5912:Traf3 UTSW 12 111255349 missense probably benign 0.01
X0052:Traf3 UTSW 12 111252736 missense probably benign 0.41
Mode of Inheritance Unknown
Local Stock Live Mice
MMRRC Submission 037517-MU
Last Updated 04/17/2017 12:46 PM by Katherine Timer
Record Created 05/08/2013 11:13 PM by Kuan-Wen Wang
Record Posted 08/21/2014
Phenotypic Description
Figure 1. Hulk mice exhibit decreased frequencies of peripheral B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Raw data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 2. Hulk mice exhibit increased frequencies of peripheral macrophages. Flow cytometric analysis of peripheral blood was utilized to determine macrophage frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Homozygous hulk mice exhibit diminished T-dependent IgG responses to ovalbumin administered with aluminum hydroxide (OVA-Alum). IgG levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 4. Homozygous hulk mice exhibit diminished T-dependent IgG responses to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal). IgG levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Hulk phenotype was identified among G3 mice of the pedigree R0143, some of which showed a decrease in the frequency of B cells (Figure 1) as well as an increase in the frequency of macrophages (Figure 2), all in the peripheral blood. The T-dependent (TD) IgG response to ovalbumin administered with aluminum hydroxide (OVA-Alum) (Figure 3) and the response to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal), another T-dependent antigen (Figure 4), were diminished. The T-independent antibody response to 4-hydroxy-3-nitrophenylacetyl-Ficoll (NP-Ficoll) was normal (not shown). 

Nature of Mutation
Figure 5. Linkage mapping of reduced B cell frequency using a dominant model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted versus the chromosomal positions of 70 mutations (X-axis) identified in the G1 male of pedigree R0143.  Raw phenotype data were used for single locus linkage analysis without consideration for G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and P = 7.143 x 10-4 for Bonferroni significance, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 70 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Traf3:  a T to A transversion at base pair 111,261,576 (v38) on chromosome 12, or base pair 95,207 in the GenBank genomic region NC_000078 encoding Traf3.  The strongest association was found with a dominant model of linkage to the reduced B cell frequency (raw data) wherein 5 homozygous variant and 25 heterozygous mice departed phenotypically from 16 homozygous reference mice with a P value of 3.174 x 10-15 (Figure 5).  A substantial semidominant effect was observed in most of the assays but the mutation is preponderantly recessive, and in no assay was a purely dominant effect observed.  The mutation corresponds to residue 1,395 in the mRNA sequence NM_001286122 within exon 12 of 12 total exons (isoform 1) and residue 1,581 in the mRNA sequence NM_011632 within exon 10 of 10 total exons (isoform 2).

 

95191 GACCTGCGGTTCCAGGTCCTCGAGACCGCCAGC
402   -D--L--R--F--Q--V--L--E--T--A--S- (Isoform 1; ENSMUSP00000021706)

377   -D--L--R--F--Q--V--L--E--T--A--S- (Isoform 2; ENSMUSP00000112517)

 

Genomic numbering corresponds to NC_000078. The mutated nucleotide is indicated in red.  The mutation results in an valine (V) to aspartic acid (D) substitution at position 407 (V407D) in the ENSMUSP00000021706 isoform and a V to D substitution at position 382 (V382D) in the ENSMUSP00000112517 isoform of the TRAF3 protein. The mutation is strongly predicted by Polyphen-2 to cause loss of function (score = 1.00).

Protein Prediction

Figure 6. Domain structure of TRAF3. Please see the text for more details about the domains shown. Abbreviations: RING, really interesting new gene; ZINC, zinc finger motifs; CC, coiled coil; TRAF, TNFR-associated factor. The Hulk mutation is a V to D substitution at position 407 (V407D).

Traf3 encodes tumor necrosis factor receptor (TNFR)-associated factor 3 (TRAF3), a member of the TRAF family of intracellular adaptor proteins. Similar to the other members of the TRAF family, TRAF3 has an N-terminal really interesting new gene (RING) finger domain (amino acids 52-87, SMART), two zinc finger domains (amino acids 135-191 & 191-250, SMART), a coiled-coil domain (amino acids 298-337, SMART), and a C-terminal meprin and TRAF homology (MATH) domain (often designated simply as the TRAF domain; amino acids 419-542, SMART) [Figure 6; (1-4); reviewed in (5)].

 

RING finger motifs are common in E3 ubiquitin ligases [reviewed in (5)]. In TRAF3, both the RING finger and zinc finger domains are required for TRAF3 E3 ligase activity, NF-κB inducing kinase (NIK; see the record for lucky) turnover, and subsequent NF-κB activation in the alternative NF-κB (NF-κB2) signaling pathway (3;6-10). Coimmunoprecipitation of an N-terminal deletion TRAF3 mutant (TRAF3Δ1–258; missing both the RING and zinc finger domains) or a Phe474Glu TRAF3 mutant with NIK determined that a polyubiquitinated form of NIK was not bound to either the TRAF3Δ1–258 or the Phe474Glu mutant, indicating that NIK association with both the TRAF domain and the RING/zinc finger domains are required for the polyubiquitination of NIK (6). Exogenous expression of a TRAF3 N-terminal deletion mutant (TRAF3Δ1–367) with the RING finger, zinc fingers, and coiled-coil domains removed exhibited inhibition of the lymphotoxin β-receptor (LTβR)-mediated cell death response (see the record kama for more information on LTβR), but not LTβR-mediated NF-κB activation or Fas-mediated cell death in vitro (see the record for riogrande for more information about Fas ligand (FasL)) (11).

 

Figure 7. Crystal structure of the TRAF domain (amino acids 364-568) of human TRAF3. The first 70 amino acids comprise an N-terminal α-helical segment. The C-terminal part of the TRAF domain is independently folded into an eight-stranded β-sandwich. Figure based on PDB:1FLK; (12). See text for more details. Figure is interactive; click to rotate.

The crystal structure of the TRAF domain of human TRAF3 has been solved [amino acids 364-568; PDB:1FLK; (12); Figure 7]. The majority of the sequence encompassing the TRAF domain folds into a β-sandwich formed by two β-sheet layers that contain four anti-parallel β-strands enclosing a hydrophobic core (12;13). The TRAF domain of TRAF3 regulates TRAF3 homotrimerization by stabilizing the TRAF3 trimer via both hydrophilic and hydrophobic interactions within the β-sandwich as well as coiled-coil interactions between the intertwined helical segments of the N-terminal α-helical portion of the domain (1;3;12). The coiled-coil domains of the TRAF3 trimer extend 77Å away from the TRAF domain cluster, forming the stalk of the trimer (12). A crevice extends across the edge of the β-sandwich of the TRAF domain (13). The surface crevice mediates protein-protein interactions through the recognition of short peptides [i.e., TRAF interacting motifs (TIMs); (P/S/A/T)-X-(Q/E)-E] within the intracellular domains of several receptors [e.g., LTβR, CD40 (see the record walla for more information about CD40 ligand (CD40L)), B cell activating factor receptor (BAFFR)], intermediate adaptor proteins [e.g., TNFR1-associated death domain protein (TRADD) and IL-1R-associated kinase (IRAK) family members], and downstream proteins [e.g., cellular inhibitors of apoptosis (cIAP)-1 and -2 and NF-κB-inducing kinase (NIK)] [(1;6;13-15); reviewed in (5)]. The surface crevice of TRAF3 contains three subregions of predominately polar, hydrophobic, or mixed polar/charged residues (16). Mutations of Tyr459 (within the mixed polar/charged subregion) and Phe512 and Phe521 (within the hydrophobic subregion) inhibited binding of LTβR (16), but did not impact binding to NIK (6). Mutation of Phe474 (at the floor of the crevice) to glutamic acid (Phe474Glu) resulted in loss of both LTβR and NIK binding (6). However, mutation of Phe474 to aspartic acid (Phe474Asp) did not alter NIK binding (6). The Phe474Glu mutation did not alter the integrity of TRAF3 as the mutant protein was able to assemble in its native conformation (6). In mouse 3T3 fibroblasts depleted of wild-type TRAF3 using short hairpin RNA, expression of the Phe474Glu mutant resulted in constitutive processing of the NF-κB precursor protein p100 (see the record for xander) to the active NF-κB p52 transcription factor similar to what is observed in TRAF3 knockout mouse embryonic fibroblasts (17) and cells in which TRAF3 was knocked down using shRNA (6).

 

K63-linked ubiquitination of TRAF3 in TRIF-dependent Toll-like receptor (TLR) signaling facilitates the recruitment and activation of effector kinases TBK1 (see the record for Pioneer) and IKKε, the subsequent activation of IRF3/7 (see the record for inept), and the production of type I interferons (IFNs) [(18); reviewed in (19)]. In response to CD40 (see the record for walla) or LTβR stimulation, Otud7b facilitates the K48-linked deubiquintination of TRAF3, preventing TRAF3 degradation and preventing aberrant NF-κB2 stimulation (20). Persistent NF-κB2 signaling leads to the expression of TRAF3 de-ubiquitinases and K48 E3 ligases that function in halting signal transduction by removing the K63-linked ubiqutination and targeting TRAF3 for proteasomal degradation, respectively [reviewed in (19)]. Deubiquitinating enzyme A (DUBA) specifically targets and removes K63-linked ubiquitin chains from TRAF3 leading to the dissociation of TRAF3 from TBK1 and the subsequent inhibition of TLR-induced type I IFN production (21). The K48-E3 ubiquitin ligase TRIAD domain containing protein 3a (TRIAD3A) along with DUBA promotes the proteasomal degradation of TRAF3 subsequently resulting in negative regulation of the RIG-I signaling pathway and type I IFN production (22). MCP-induced protein 1 (MCPIP1) is also an effector in the deubiquitination of TRAF3; MCPIP1 deficiency results in fatal inflammatory disorders in the mouse (23). TRAF autoubiquitination provides docking sites for adaptors and kinases that contain ubiquitin-binding motifs, resulting in kinase activation and subsequent associated functions (18;24). Following TLR4 stimulation, cIAP1/2-mediated K48-linked ubiquitination of TRAF3 results in degradation of TRAF3, and correlates with the translocation of the MyD88-containing signaling complex from the cell membrane to the cytoplasm and the subsequent induction of MAPK signaling and proinflammatory cytokine production [(18); reviewed in (19)]. Ubiquitin-specific protease 25 (USP25) reverses MyD88-dependent cIAP1/2-mediated K48-linked polyubiquitination of TRAF3 upon LPS stimulation of the TLR4 signaling pathway (25). During anti-viral responses in Sendai virus-infected HEK293T cells, OTUB1 and OTUB2 reduce TRAF3 ubiquitination and type I IFN production (26). TRAF3 also functions as a K48- and K63-linked E3 ubiquitin ligase [reviewed in (19)]. TRAF3-mediated K63-linked polyubiquitination and its function as an adaptor protein occur simultaneously and coordinately.

 

TRAF3 undergoes posttranslational modification by small ubiquitin-related modifier (SUMO)-1 and SUMO-2/3 via Ubc9, a SUMO conjugating enzyme (27). Ubc9-dependent TRAF3 SUMOylation regulates association of TRAF3 with CD40, subsequently influencing TRAF3 degradation and NF-κB2 activation upon CD40 ligation (see “Background” for more information about CD40-associated signaling) (27).

Traf3 encodes multiple isoforms resulting from alternative splicing (ENSEMBL and NCBI). The transcript encoding isoform 2 (ENSMUSP00000112517) varies from the canonical Traf3 in that it lacks an internal exon in the 5’ untranslated region (5’-UTR) as well as an in-frame exon in the coding region. As a result, the coded isoform 2 protein lacks an internal segment of the canonical TRAF3 protein. The putative function(s) of this isoform has not been studied.

 

The Hulk mutation is within the region between the coiled-coil and TRAF domains; the mutation is not within a defined/predicted domain, repeat, motif, or feature.

Expression/Localization

TRAF3 is ubiquitously expressed (1;2). TRAF3 is localized within the cytoplasm of cells. For more information about the regulation of TRAF3 expression/localization, please see both the “Protein Prediction” and “Background” sections.

Background

The TRAF proteins function in the signal transduction pathways initiated by several members of the TNFR, TLR, interleukin-1 receptor (IL-1R), and RIG-I-like receptor (RLR) families [reviewed in (5)]. The TRAF-mediated recruitment of signaling proteins into protein complexes subsequently controls several signal transduction pathways (28). TRAF3 functions in signaling pathways in several cell types including B cells, T cells, dendritic cells, macrophages, and osteoclast precursors [reviewed in (29)]. TRAF3 directly interacts with the cytoplasmic regions of several proteins including LTβR, TNFR80, CD40, TACI, BCMA, CD27, CD30, LMP1, BAFFR, receptor activator of NF-κB (RANK), herpesvirus entry mediator (HVEM), proliferation-inducing ligand (APRIL), ectodysplasin A receptor (EDAR; see the record achtung2), X-linked ectodermal dysplasia receptor (XEDAR), CD137 (4-1BB), OX40, and glucocorticoid-induced TNFR-related gene (GITR) (2-4;30-33). TRAF3 also indirectly interacts with other receptors including TNFR1 and IL-1R as well as TLR3, TLR4 (see the record for lps3), TLR7 (see the record for rsq1), and TLR9 (see the record for CpG1) by associating with adaptor proteins [(34); reviewed in (5)]. TRAF3-associated signaling is described in more detail, below.

 

Figure 8. The non-canonical NF-κB signaling pathway. A subset of TNFR superfamily members such as the lymphotoxin-β receptor (LT-βR),CD40, B-cell-activating factor receptor (BAFFR) and receptor activator of NF-κB (RANK) can activate the canonical or non-canonical NF-κB signaling pathways. In the non-canonical pathway, the receptors bind to TRAFs to regulate NIK activity. TRAF3 and TRAF2 are recruited to the receptor along with cIAP1/2. TRAF2 undergoes K63 self-ubiquitination and is responsible for the K63 ubiquitination of cIAP1/2. TRAF3 is degraded by K48 ubiquitination, enhanced by the K63 ubiquitination of TRAF2 and cIAP1/2. (Gray arrows represent ubiquitination dependence.) As TRAF levels decrease, NIK is released and phosphorylates IKKα which phosphorylates p100. Phosphorylation and ubiquitination of p100 leads to the 26S proteasomal degradation of p100 and the processing of p52. P52 and RelB are released for translocation to the nucleus. This image is interactive. Click on the image to view mutations in the pathway (red) and the genes affected by these mutations (black). Click on the mutations for more specific information.

Alternative NF-κB signaling

TRAF2, 5, and 6 activate the classic (i.e., canonical) NF-κB (NF-κB1) signaling pathway (for information about canonical NF-κB signaling, please see the record finlay). In contrast, TRAF3 functions in the alternative (i.e., non-canonical) NF-κB (NF-κB2) signaling pathway [Figure 8; (17;35); reviewed in (5)]. The NF-κB2 pathway regulates secondary lymphoid organogenesis via LTβR-associated signaling (see the record kama), thymic epithelial cell development, and iNKT cell development as well as B cell development, maintenance, and antibody production; T cell survival is not regulated by the NF-κB2 pathway (30;36-43). TRAF3 is constitutively bound to NIK, an activator of the NF-κB2 pathway, and the TRAF2-cIAP1/2 complex in unstimulated cells (8;28;44;45). TRAF3 promotes the K48-linked ubiquitination of NIK by sequestering NIK into a complex containing TRAF2 and cIAP1/2, subsequently negatively regulating the NF-κB2 pathway (35;46). Upon receptor (e.g., CD40, LTβR, BAFFR, RANK, or TWEAK) activation, the TRAF2-cIAP1/2 complex is recruited to the receptor and K63-linked ubiquitination of TRAF2 and cIAP1/2 occurs [(11;28;46); reviewed in (19)]. K63-linked ubiquitination of cIAP1/2 promotes cIAP1/2-mediated switching of the K48-linked ubiquitin chains from NIK to TRAF3, the subsequent degradation of TRAF3, and release of NIK  (28;46). Accumulation of NIK results in its autophosphorylation, leading to IKKα activation and p100 processing to p52 [reviewed in (5)]. The p52/RelB heterodimer is subsequently activated and translocates to the nucleus to activate the transcription of target genes. For a detailed description of the NF-κB2 pathway, please see the record for xander and lucky.

 

Traf3 knockout mice (Traf3-/-; Traf3tm1Bal; MGI:2135257) exhibit runting by postnatal day 3 (P3), hypoglycemia, depletion of peripheral white blood cells, and premature lethality by P10-12 (47). The premature lethality has been attributed to the constitutive activation of the NF-κB2 signaling pathway upon the loss of TRAF3-mediated NIK regulation (17;28;30;38;39;46); pups from a mating of the Traf3-/- mice with p100 knockout mice (p100-/-) exhibited normal growth rates into adulthood (17). No gross defects were observed in the structures of the brain, lung, heart, thymus, liver, kidney, and spleen in the Traf3-/- mice (47). However, the lymphoid organs in the Traf3-/- mice were smaller than in the wild-type mice and by P7, the spleen was rudimentary, although the structure of the spleen was intact (47). At P7, CD4+CD8+ double positive thymocytes as well as the percentages of bone marrow B220+IgM B lineage precursors were reduced, but granulocytic lineage cells were normal, compared to those in wild-type mice. Transplantation of Traf3−/− fetal liver cells into lethally irradiated wild-type mice resulted in reconstitution of T, B, granulocytic, and erythroid cell lineages (47). Xu et al. propose that the loss of white blood cells in the Traf3-/- mice was due to an upregulation of cytotoxic factors and that they were not intrinsically prone to die (47).

 

Figure 9. Overview of Toll-like receptor (TLR) signaling pathways. Shown are the signaling events downstream of TLR activation that ultimately lead to the induction of thousands of genes including TNF and type I IFN, which are critical in activating innate and adaptive immune responses. TLR1,2,4,5 and 6 are located at the cell surface, while TLR3,7, and 9 are localized in the endosome. Once TLR complexes recognize their ligands, they recruit combinations of adaptor proteins (MyD88, TICAM, TRAM, TIRAP) via homophilic TIR domain interactions.

In the MyD88-dependent pathway utilized by all TLRs except TLR3, MyD88 (lime green) recruits IRAK kinases through their death domains (DD). TRAF6 and IRF5 are also recruited to this complex. Phosphorylation of IRAK1 by IRAK4 allows dissociation of IRAK1 and TRAF6. K63 ubiquitination (small light blue circles) of TRAF6 recruits TAK1 and the TAK1 binding proteins, TAB1 and TAB2. Activation of TAK1 leads to activation of MAP kinase cascades and the IKK complex. NEMO polyubiquitination by TRAF6 is necessary for IKK complex function. The IKK complex phosphorylates IκB, p105, and TPL2 (or MAP3K8), resulting in IκB and p105 ubiquitination and degradation (small pink circles), releasing NF-κB into the nucleus and permitting TPL2 to become activated, respectively. Activation of the p38, JNK and ERK1/2 kinases leads to the activation of both CREB and AP1, which in turn induce many target genes. In pDCs, activation of TLR7 and 9 in endosomes recruits MyD88 and IRAK4, which then interact with TRAF6, TRAF3, IRAK1, IKKα, osteopontin (OPN), and IRF7. IRAK-1 and IKKα phosphorylate and activate IRF7, leading to transcription of interferon-inducible genes and production of large amounts of type I IFN.
 
In the TICAM-dependent pathway stimulated by TLR3 or 4 activation, TICAM (bright yellow) recruits polyubiquitinated RIP1, which interacts with the TRAF6/TAK1 complex and leads to NF-κB activation and proinflammatory cytokine induction. TICAM signaling also leads to type I IFN production through phosphorylation and activation of IRF3 by a complex containing TRAF3, TBK1 and IKKe; RIP1 is not required for TICAM-dependent activation of IRF3.

Note that TLR4 signals through the MyD88-dependent pathway from the cell membrane and is subsequently internalized into late endosomes to signal through the TICAM-dependent pathway. When bound to vesicular stomatitis virus glycoprotein G (VSV-G) (far left), TLR4 can signal through TRAM to induce IRF7 activation, a process that is partially dependent on TICAM. Upon viral stimulation, TLR2 may also be internalized into endosomes to activate both IRF3 and IRF7 by an unknown mechanism. LTA = lipoteichoic acid; LP2 = lipopeptide 2. PAM3CSK4 is a triacyl lipopeptide. Phosphorylation events are represented by small yellow circles labeled with a “P”. This image is interactive. Click on the image to view mutations found within the pathway (red) and the genes affected by these mutations (black). Click on the mutations for more specific information.

TLR signaling and TRAF3

TLRs induce innate immune responses and the production of pro-inflammatory cytokines, IFNs, and anti-inflammatory cytokines upon recognition of microbial molecules. TRAF3 associates with TRIF (see the record for Lps2) and MyD88 (see the record for pococurante) [Figure 9; (34)]. The MyD88-dependent pathway induces an early-phase activation of NF-κB and MAP kinases. In plasmacytoid dendritic cells, activation of TLR7 and 9 in endosomes recruits MyD88 and IRAK4, which then interact with TRAF6, TRAF3, IRAK1, IKKα, osteopontin (OPN), and IRF7. IRAK-1 and IKKα phosphorylate and activate IRF7, leading to transcription of interferon-inducible genes and production of large amounts of type I IFN. TRIF-dependent signaling stimulated by TLR3 activation leads to type I IFN production through phosphorylation and activation of IRF3 by a complex containing TRAF3, TBK1 and IKKε. LPS-mediated activation of TLR4 results in TRIF-dependent K63-linked ubiquitination of TRAF3 and the activation of TBK1 and IKKɛ, which subsequently phosphorylate and activate IRF3 [(18;21); reviewed in (5)]. Activation of TLR4 also induces the recruitment, and activation, of cIAP1/2 into a complex that contains TRAF3, TRAF6, UBC13, IKKγ and TAK1 (18). Activation of TLR4 results in the cIAP-mediated K48-linked ubiquitination and subsequent degradation of TRAF3. TRAF3 negatively regulates TLR4-induced MyD88-dependent JNK and p38 activation. TLR4-induced JNK and p38 activation require cIAP-mediated K48-linked ubiquitination and degradation of TRAF3 as well as TAK1 activation [reviewed in (5)]. At the endosome, TRAF3 acts as a positive regulator of TLR9-MyD88- and TLR4-dependent IFN production  (34;48). However, TRAF3 acts as a negative regulator of TLR4 at the cell membrane. For a detailed description of TLR signaling please see the record lps3.

 

The cell-specific functions of TRAF3 are described in more detail, below.

 

TRAF3 in B cells

TRAF3 functions as a negative regulator of B cell survival and homeostasis via its role in the NF-κB2 signaling pathway [(38;49); reviewed in (19)].

 

B cell-specific Traf3 knockout mice (B-TRAF3-/-; Traf3ΔB) were generated by producing Traf3lox/lox mice (Traf3tm1Rbr; MGI:3777324) and mating them to mice that were heterozygous for a Cd19-CRE allele (30;38). B-TRAF3-/- mice exhibited enlarged spleens and lymph nodes as well as increased cellularity and expansion of T2 transitional (B220+AA4.1+IgM+CD23+ or B220+AA4.1+IgM+IgD+), marginal zone (MZ; B220+IgM+CD21hiCD23int or B220+IgM+CD1d+CD9+), and follicular (B220+IgM+CD21intCD23hi) B cells; other immune cell types, including the levels of B1a (B220+CD11b+CD5+), B1b (B220+CD11b+CD5), B2 (B220+CD11b-CD23+), pro-B (B220+IgM-c-Kit+CD25), pre-B (B220+IgM-c-Kit-CD25+), immature (B220+AA4.1+IgM+IgD), and recirculating mature (B220+AA4.1-IgM+IgD+) B cell subsets, were not affected and the thymus size was comparable to wild-type mice (30;38). As a result of the expansion of B cells, the B-TRAF3-/- mice exhibited splenomegaly, lymphadenopathy, hyperimmunoglobulinemia, and autoimmune reactivity (30).  Basal serum IgM, IgG2a, IgG2b, IgG3, and IgA levels in the B-TRAF3-/- mice were elevated compared to those in wild-type mice (30). Ex vivo B-TRAF3-/- B cell cultures exhibited enhanced factor-independent cell survival (independent of BAFF) as well as increased NF-κB2 levels and decreased PKCδ in the nucleus compared to those from littermate controls [(49); reviewed in (29)]. Approximately 30% of B-TRAF3-/- mice develop spontaneous B cell malignancies between 9 and 18 months of age (50).

 

Transgenic mice that express a human TRAF3 in lymphocytes (B-TRAF3-Tg) exhibited reduced survival (lethality >9 months) compared to wild-type mice (51). In the B-TRAF3-Tg mice, there was an age-dependent phenotype of oily hair by 2-3 months after birth, runting, and cachexia (51). The B-TRAF3-Tg mice exhibited reduced organ (i.e., liver, kidneys, lungs, heart, and spleen) sizes and weights as well as plasmacytosis (51). The reduction in spleen size was age-dependent; younger mice did not exhibit significant differences in spleen size from wild-type mice (51). In the B-TRAF3-Tg mice, there was a significant increase in the ratio of T to B cells and total numbers of B220+ B cells were reduced in older mice compared to wild-type mice (51). The ratio of mature (IgDH) and immature (IgMH) B cells was not significantly different in the transgenic mice compared to controls (51). Serum levels of inflammatory cytokines including TNF, MCP-1 and IFN-γ were increased in the B-TRAF3-Tg mice compared to controls (51). In addition, the transgenic mice exhibited higher concentrations of autoantibodies compared to wild-type mice as well as arthritis and glomerular lesions consistent with autoimmune kidney disease (51). With age, 50% of B-TRAF3-Tg mice developed squamous cell carcinoma of the tongue and 43% of the parotid glands from B-TRAF-Tg females had tumors; lung cancers and hepatocellular carcinomas were also observed (51).

 

B cell signaling and TRAF3

TRAF3 functions in regulating signaling and effector functions downstream of several B cell receptors.

 

CD40 and LMP1

TRAF3 is a negative regulator of CD40-associated signaling in B cells (52). CD40 is a TNFR family member in B cells, dendritic cells, and epithelial cells (53). In B cells, CD40 activation results in proliferation, differentiation, isotype switching, cytokine secretion, and germinal center formation (54). Upon CD40 activation, TRAF2, TRAF6, TRAF3, cIAP1/2, UBC13, MEKK1 (mitogen-activated protein kinase (MAPK) kinase kinase), TAK1, and IKKγ are recruited to the cytoplasmic domain of CD40 (24). These proteins subsequently form two multiprotein complexes: one is composed of TRAF2, MEKK1, TRAF3, cIAP, UBC13 and IKKγ, while the other is composed of TRAF6, TAK1, TRAF3, cIAP, UBC13, and IKKγ (24;28). The TRAF2, UBC13, IKKγ complex activates the MEKK1 and MAPK cascades upon cIAP1/2-mediated degradation of TRAF3 (24). TRAF3 competes with TRAF2 in CD40 binding, subsequently inhibiting the TRAF2-dependent synergy between CD40 and B cell antigen receptor signals (55). The degradation of TRAF3 upon K48-linked ubiquitination by cIAP1/2 facilitates the release of the MEKK1 signaling complex (containing IKKγ and UBC13) into the cytoplasm and the subsequent activation of MEKK1 and its downstream targets MAPKK4 and MAPKK7 [(24;28); reviewed in (5)]. CD40 stimulation also activates the NF-κB2 pathway. CD40-associated signaling results in activation of several kinases including p38, JNK, ERK, and Akt as well as the activation of transcription factors such as NF-κB1 and AP-1 (30). Subsequently, adhesion and costimulatory molecules are upregulated, proliferation occurs, and antibodies and cytokines are secreted (56). In TRAF3−/− B cell lines, CD40-mediated activation of ERK, AKT, p38 kinases, and NF-κB1 were not significantly altered, while CD40-mediated activation of JNK and antibody production were increased (52). CD40-mediated upregulation and production of IL-6 and TNFα in B cells appear to be TRAF3-independent (52). For a detailed description of CD40, please see the record for walla.

 

TRAF3 also associates with LMP1, a dominant oncogene product of Epstein-Barr virus and mimic of CD40 in B cells [(2-4;33); reviewed in (19)]. LMP1 induction results in amplified and sustained B cell activation [reviewed in (29)]. TRAF3 association with LMP1 recruits TRAF5 to the LMP1 signaling complex (57). In contrast to CD40-associated polyubiquitination and degradation of TRAF3, LMP1 activation does not induce the degradation of TRAF3 (58). The differences between CD40 and LMP1 are predicted to be due to the differences between TRAF2 association with the receptors: LMP1 exhibits weak TRAF2 binding compared to CD40 in B cells (52). In TRAF3−/− B cells, signaling by LMP1 was defective in that LMP1-induced activation of JNK, p38, and NF-κB as well as antibody secretion was impaired (52;59).

 

BAFFR signaling

BAFFR, TACI, and APRIL are closely related TNFR family members that function in B cell development, homeostasis, and function by binding to the B cell survival factor BAFF; mature B cells only require BAFFR to survive [(60); reviewed in (29)]. BAFFR signaling weakly induces the NF-κB1 and JNK pathways (61;62), but strongly induces the NF-κB2 and protein kinase C δ (PKCδ) pathways to promote B cell survival [reviewed in (29)]. All three receptors bind TRAF3 (63-65). TRAF2 and TRAF3 cooperate to constitutively suppress the signals initiated by BAFF (38;64). In order for BAFF/BAFFR-associated signaling to sustain B cell development and homeostasis, the TRAF2/TRAF3-mediated suppression of B cell survival must be reversed (38). Association of TRAF3 with TRAF2 induces the degradation of TRAF3, releasing the TRAF3-induced suppression of B cell survival (8;28;64). Blockade of BAFF binding to the BAFFR in wild-type B cells resulted in decreased proportions of MZ B cells (30). However the proportions of these cells in B-TRAF3-/- mice did not change, indicating that the hyperplasia observed in B-TRAF3-/- mice is independent of BAFF binding (30).  The levels of the NF-κB2 subunits p52 and RelB are increased in B-TRAF3-/- B cells (30;38). In addition, B cells of B-TRAF3-/- mice exhibited decreased nuclear PKCδ levels (30).

 

TLRs in B cells

In B cells, TRAF3 is a negative regulator of TLR3, TLR4, TLR7, and TLR9 responses (49). It has been proposed that TRAF3 and TRAF5 play complementary roles in regulating TLR signals in B cells [reviewed in (29)]. TRAF5 inhibits the MAPK pathway downstream of TLRs, but does not alter the NF-κB1 pathway (66). B cells from TRAF3-deficient mice have increased NF-κB1-associated cytokine production (i.e., IL-6, IL-10, and TNF) and Ig isotype switching in response to TLR3, TLR4, TLR7, and TLR9 (49). B-TRAF3-Tg mice exhibited increased production of IgG1 and IgG2b in response to TLR4 and TLR9 activation; B cells from the B-TRAF3-Tg mice proliferated at similar rates to wild-type mice (51). Taken together, these results indicate that TRAF3 regulates TLR-mediated B cell differentiation (51).

 

TRAF3 in T cells

TRAF3 functions in early stages of T cell development including pre-TCR signaling and early stage expansion of thymocytes; TRAF3 is not required after the double-positive stage. In addition, TRAF3 is essential for the production of IgG1 in TD antibody responses (see the “Putative Mechanism” section for more details on TRAF3 function in TD and TI antibody responses) (39;67)

 

Examination of a T cell-specific Traf3 knockout mouse (T-TRAF3-/-; CD4CreTRAF3flox/flox) determined that loss of TRAF3 expression in T cells does not alter the number and ratio of T cell subsets (i.e., CD4 or CD8 single positive, double-positive, or double-negative cells) or the survival of the T cells in vitro even though NF-κB2 is constitutively active (38;39). However the T-TRAF3-/- mice exhibited a two-fold increase of CD4+CD25+Foxp3+ regulatory T cells (Tregs) (39). The function of TRAF3 in Treg cells was further examined using a Treg-specific knockout mouse (Traf3Treg-KO) (67).  The Traf3Treg-KO mice exhibited impaired CD4 T cell homeostasis characterized by an increase in Th1 effector/memory T cells.  Antigen-stimulated activation of follicular T helper cells, formation of germinal centers, and high-affinity IgG antibody production were elevated in Traf3Treg-KO mice (67). The T-TRAF3-/- mice also exhibited a decrease in invariant natural killer T (iNKT) cells in the spleen, liver, and thymus due to defects at developmental stages 2 and 3 (not stage 0 and 1) [(68); reviewed in (19)]. TCR-associated signaling in stage 1 of iNKT development was impaired; TCR signaling at earlier developmental stages was not changed upon loss TRAF3 expression. Loss of TRAF3 expression in T cells did not promote survival (28;39); fewer single positive T cells entered the cell cycle (S/G2/M phase) and more underwent activation-induced apoptosis (39). The T-TRAF3-/- mice exhibited slightly larger spleens and normal lymph nodes compared to wild-type mice (39). Loss of TRAF3 expression results in impaired CD8+ and CD4+ T-cell responses to infection with Listeria monocytogenes (39).  In another T-TRAF3-/- model (LckCreTRAF3flox/flox), the numbers of peripheral CD4+ and CD8+ T cells were reduced (68). The differences observed between the two strains was attributed to the fact that LckCre mediated Traf3 deletion occurs at the double-negative stage of T cell development compared to CD4Cre-mediated deletion of Traf3 occurring at the double-positive stage [reviewed in (29)].

 

T cell signaling and TRAF3

TCR/CD28

In T cells, TRAF3 is essential for TCR/CD28-mediated signaling and is recruited to the TCR complex in a CD28-dependent manner (39). In TRAF3-deficient Treg-depleted mice, early signaling events mediated by TCR/CD28 (e.g., phosphorylation of ZAP70 (see the record for murdock), LAT, PLC-γ (please see the record for queen), and ERK) are impaired; changes to TCR-induced NF-κB1 activation were not observed (39). For an in-depth description of TCR/CD28-associated signaling, please see the record for murdock.

 

T cell TLRs

TLR3, TLR4, TLR7, and TLR9 are expressed in T cells and T cell activation leads to TLR upregulation (70;71); the role of TRAF3 in TLR-associated signaling in T cells has not been studied.

 

Other signaling

Upon binding of IL-17 to the IL-17 receptor (IL-17R), TRAF3 is recruited to the receptor. TRAF3 is proposed to negatively regulate IL-17R-associated NF-κB signaling by preventing the formation of the IL17R/Act1/TRAF6 complex (69).

 

OX40, a member of the TNFR family, is an inducer of NF-κB in T cells that interacts with TRAFs 1, 2, and 3 after TCR stimulation (72-74). In epithelial cells, TRAF3 inhibits OX40-mediated activation of NF-κB (75). The function of TRAF3 in OX40-associated signaling in T cells is unknown.

 

4-1BB/CD137 mediates activated T cell survival and has binding sites for TRAFs 1, 2, and 3 (74;76). The stimulation of 4-1BB in mouse CD8+ T cells promotes the cIAP-dependent degradation of TRAF3 (77).

HVEM interacts with several ligands including LIGHT and lymphotoxin α/β. Upon activation, HVEM binds to TRAFs 1, 2, 3, and 5 (78). The interaction of LIGHT with HVEM is essential for CD4+ T cell survival (79).

GITR is expressed on T cells and is upregulated upon TCR stimulation (80). In viral infections, GITR functions in CD8+ T cell expansion and survival (81). In transfected epithelial cells, TRAF3 inhibited GITR-mediated NF-κB activation (82), but its function in T cells has not been studied.

TRAFs 1, 2, 3, and 5 interact with CD30 to induce NF-κB (83;84). CD30 promotes T cell survival, generation of memory CD8+ T cells, and Th17 differentiation (85;86).

 

TRAF3 in other immune cells

TRAF3 negatively regulates p38, JNK, and NF-κB signaling, but positively regulates TLR-associated signaling in response to viral nucleic acids and LPS in myeloid cells (i.e., granulocytes and monocytes) (34;48;49;87;88). In TRAF3 deficient myeloid cells, TLR4 and TLR9 stimulation resulted in increased IL-12 and IL-6 production (34;48). Retinoic acid inducible gene (RIG-I) and melanoma differentiation associated protein 5 (MDA5) recognize viral RNA and signal through mitochondrial anti-viral signaling protein (MAVS) to promote type I IFN production. In myeloid cells, TRAF3 is K63-linked ubiquitinated to facilitate the recruitment of TBK1 and type I IFN production upon interaction with MAVS (88;89). DUBA removes the K63-linked ubiquitin chains from TRAF3, while Triad3A-mediated ubiquitination, and subsequent degradation, of TRAF3 negatively regulates RIG-I- and MDA5-associated signaling (22).

In bone marrow-derived macrophages (BMDMs), plasmacytoid dendritic cells (pDCs), and mouse embryonic fibroblasts, TRAF3 is required for the induction of type I IFNs and IL-10, but is dispensable for pro-inflammatory cytokine expression in response to viral (e.g., vesicular stomatitis virus (VSV)) infection as well as TLR ligation (34;48). Bone marrow-derived dendritic cells from a DC-specific TRAF3 knockout (DC-TRAF3−/−) mouse produced increased IκBα phosphorylation and IL-12 amounts as well as reduced IL-10 and IFN-α amounts in response to TLR4, TLR7, and TLR9 stimulation compared to wild-type controls [(49); reviewed in (19)].  MAPK activation was not changed upon the loss of TRAF3 [reviewed in (19)]. The DC-TRAF3−/− DCs exhibited constitutive processing of p100 to p52, indicating that TRAF3 has a negative regulatory role in the NF-κB2 pathway in DCs; in BMDMs, TRAF3 was not required for NF-κB activation (17;28). TRAF3 deficiency did not enhance the survival of DCs (28;39).

 

Osteoclastogenesis

NF-κB signaling downstream from RANK and TNFR in osteoclast precursors (OCPs) induces osteoclast (OC) formation and mediates bone destruction in bone diseases such as osteoarthritis and rheumatoid arthritis (90;91). Two lines of osteoclast-specific Traf3 knockout (C-cKO, Traf3f/f;cathepsin Kcre; L-cKO, Traf3f/f;lysozyme Mcre) mice exhibited mild osteoporosis and increased osteoclast formation (91). TNF limits RANKL- and TNF-induced osteoclast formation by increasing expression of TRAF3, and subsequently, p100 accumulation in OCPs (90). SiRNA-mediated knockdown of Traf3 prevented TNF-induced p100 accumulation and inhibition of osteoclastogenesis, indicating that TRAF3 upregulation (or p100 expression) in OCPs limits bone destruction and inflammation-induced bone loss in bone diseases (90).  

 

TRAF3 and human diseases

An autosomal dominant mutation in TRAF3 has been linked to susceptibility to Herpes simplex virus-1 (HSV-1)-induced encephalitis 3 (HSE; OMIM: #614849), an infection of the central nervous system that peaks in childhood (87). HSE results in focal necrotizing infections affecting the temporal and subfrontal regions of the brain and, if untreated, HSE is fatal in 70% of cases.

 

Mutations and deletions in TRAF3 are often observed in B cell malignancies including multiple myeloma, Waldenström's macroglobulinemia, non-Hodgkin lymphoma, splenic marginal zone lymphoma, B-cell chronic lymphocytic leukemia, and mantle cell lymphoma [(92-95); reviewed in (29)]. Yi et al. proposed that the loss or truncation of the TRAF3 gene observed in the B cell malignancies is due to the close proximity of TRAF3 to the IGH locus, a locus that is subject to frequent translocation [reviewed in (29)]. Elevated NF-κB2 activity due to changes in TRAF3 are proposed to lead to enhanced B cell survival and an increased propensity for malignant transformation [reviewed in (19)].

Putative Mechanism

The role of TRAF3 in TD and TI immune responses has been examined. Transfer of TRAF3-deficient liver stem cells into irradiated wild type mice (TRAF3 chimeric mice) determined that TD IgG production in response to NP15–CG was impaired (47). In the B-Traf3−/− mice, TI immune responses were increased (30). Immunization of the B-Traf3−/− mice with the TD antigen TNP-KLH resulted in increased NP-specific IgM response, but a normal NP-specific IgG1 response compared to control mice (30). In T-Traf3−/− mice, the IgG1 response to TNP-KLH was impaired at all timepoints examined (39). In addition, TNP-specific IgM response was slightly decreased at day 7; TNP-specific IgM responses at day 14 and day 28 were comparable to littermate controls (39). TI IgG production in response to NP-Ficoll was normal in the TRAF3 chimeric mice (47). In the B-Traf3−/− mice, the TI immune response to NP-Ficoll was increased and B-Traf3−/− mice exhibited high titers of NP-specific IgM, IgG1, IgG2a, IgG2b, and IgG3 antibodies (30). In the B-TRAF-Tg mice, IgM-specific responses to TNP-BSA (TD) or TNP-LPS (TI) were normal (51). However IgG1 and IgG2 responses to both antigens were increased (51). Similar to the T-Traf3−/− mice, the TI IgM response in hulk was normal; TI IgG responses in hulk have not been examined. The hulk mice exhibit a deficiency in the TD IgG responses to OVA/alum and rSFV-encoded β-gal; a TD IgM response was not assayed. Taken together, TRAF3 is essential for T helper cell function in antigen-specific IgG responses to TD antigens (39;51). Whereas B cell-specific TRAF3 deficiency enhanced B cell survival (30), the Hulk mutation resulted in a reduction in the percentage of B cells in the blood relative to wild-type mice. The levels and activity of NF-κB2 pathway components in the hulk mice have not been examined.

Primers PCR Primer
Hulk(F):5'- TTGAGCCTGAATGAGCAGTGATGG -3'
Hulk(R):5'- AGCGACAAGTGTGTCCCTTTCC -3'

Sequencing Primer
Hulk_seq(F):5'- GTACCTTGTGACGACCAGAG -3'
Hulk_seq(R):5'- AAGTGTGTCCCTTTCCCCATTC -3'
Genotyping

Hulk genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transversion.
 

PCR Primers

Hulk(F): 5’- TTGAGCCTGAATGAGCAGTGATGG-3’

Hulk(R): 5’- AGCGACAAGTGTGTCCCTTTCC-3’

 

Sequencing Primers

Hulk_seq(F): 5’- GTACCTTGTGACGACCAGAG-3’
 

Hulk_seq(R): 5’- AAGTGTGTCCCTTTCCCCATTC-3’

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               ∞

 

The following sequence of 677 nucleotides (from Genbank genomic region NC_000078 for linear DNA sequence of Traf3) is amplified:

94726                                                  ttgag cctgaatgag
94741 cagtgatggt ttgttttcat gggaggatta gggagtaggg gtggattaaa cagatggaag
94801 tgtgtgctta ggatagaaga ggagacagcg tggattcaga gcctttgtcc ctgaggaggc
94861 caggactata gggcaggaaa cacagcaagt aggtagtcag actctgacag ctgtggcctg
94921 gcgattggta ccttgtgacg accagagaag aggggaggaa agattcaaca cagatgcccc
94981 acgccgtgcc tgctttgcat atgcccaccc tctgcactca cagtggtgtc tgtggactgg
95041 tgttccagac accggtgcag gtgtgctccg acgttttcat gtctcgtttg tttgccaaat
95101 gttttcttgc ctatgacagg cttgctggag tcccagctga gccggcatga ccagatgttg
95161 agtgttcatg acatccgctt ggccgacatg gacctgcggt tccaggtcct cgagaccgcc
95221 agctacaacg gggtgctgat ctggaagatc cgtgactaca agcgccggaa gcaggaggcc
95281 gtcatgggga agaccctgtc tctctacagc cagcctttct acacaggtta ttttggctat
95341 aagatgtgtg ccagggtcta cctgaatggg gacggaatgg ggaaagggac acacttgtcg
95401 ct

 

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red text.

References
Science Writers Anne Murray
Illustrators Diantha La Vine, Peter Jurek
AuthorsKuan-Wen Wang, Jin Huk Choi,Ming Zeng, Bruce Beutler