Incidental Mutation 'R1400:Fads3'
ID160358
Institutional Source Beutler Lab
Gene Symbol Fads3
Ensembl Gene ENSMUSG00000024664
Gene Namefatty acid desaturase 3
Synonyms
MMRRC Submission 039462-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1400 (G1)
Quality Score157
Status Not validated
Chromosome19
Chromosomal Location10041548-10059671 bp(+) (GRCm38)
Type of Mutationsplice site (4 bp from exon)
DNA Base Change (assembly) A to G at 10056300 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000111659 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115995] [ENSMUST00000115995]
Predicted Effect probably null
Transcript: ENSMUST00000115995
SMART Domains Protein: ENSMUSP00000111659
Gene: ENSMUSG00000024664

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Cyt-b5 27 101 6.21e-16 SMART
Pfam:FA_desaturase 162 423 4.1e-35 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000115995
SMART Domains Protein: ENSMUSP00000111659
Gene: ENSMUSG00000024664

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Cyt-b5 27 101 6.21e-16 SMART
Pfam:FA_desaturase 162 423 4.1e-35 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fatty acid desaturase (FADS) gene family. Desaturase enzymes regulate unsaturation of fatty acids through the introduction of double bonds between defined carbons of the fatty acyl chain. FADS family members are considered fusion products composed of an N-terminal cytochrome b5-like domain and a C-terminal multiple membrane-spanning desaturase portion, both of which are characterized by conserved histidine motifs. This gene is clustered with family members FADS1 and FADS2 at 11q12-q13.1; this cluster is thought to have arisen evolutionarily from gene duplication based on its similar exon/intron organization. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous knockout affects highly unsaturated fatty acid levels in the liver and brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik G T 9: 92,351,127 C25F probably benign Het
9130008F23Rik T C 17: 40,880,304 E78G probably damaging Het
Acsf2 T C 11: 94,570,316 I345V probably benign Het
Akap11 T A 14: 78,513,962 K328N probably damaging Het
Aoc1 T A 6: 48,906,283 Y364* probably null Het
Aoc1 A T 6: 48,906,711 Q507L probably benign Het
Atp6v1c2 T C 12: 17,289,130 T207A probably benign Het
Atr C A 9: 95,862,848 Q73K probably benign Het
Cage1 A G 13: 38,032,424 S17P possibly damaging Het
Cfap44 A T 16: 44,421,212 I649F probably benign Het
Cops4 A G 5: 100,533,546 K200R probably damaging Het
Crygd A G 1: 65,063,208 S32P probably damaging Het
Cyp3a11 A G 5: 145,862,489 I296T probably damaging Het
Fbn2 T C 18: 58,080,193 E974G possibly damaging Het
Gcgr A G 11: 120,534,986 H45R probably benign Het
Gcn1l1 T C 5: 115,614,161 I2112T probably damaging Het
Gm43302 A T 5: 105,274,756 I470N probably damaging Het
Hoxa13 C G 6: 52,260,647 probably benign Het
Hoxa13 G C 6: 52,260,648 probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Krt13 C A 11: 100,121,284 G71V probably damaging Het
Las1l T C X: 95,946,900 T390A possibly damaging Het
Lifr T A 15: 7,190,865 V992E probably benign Het
Mbd5 T C 2: 49,274,776 probably null Het
Mzf1 C A 7: 13,052,771 R124L possibly damaging Het
Ndst3 A G 3: 123,556,828 F636S probably damaging Het
Necab1 T C 4: 14,975,185 D232G possibly damaging Het
Nlrp4e A T 7: 23,321,660 E524V possibly damaging Het
Nxf3 T A X: 136,076,045 T349S probably benign Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfr1013 T C 2: 85,770,133 C111R possibly damaging Het
Olfr1259 T A 2: 89,943,542 H191L possibly damaging Het
Olfr722 A T 14: 49,895,691 I37K possibly damaging Het
Olfr847 A G 9: 19,375,062 V273A probably damaging Het
Ppm1e T A 11: 87,231,766 N455I probably damaging Het
Prkag2 G A 5: 24,873,918 T158I probably damaging Het
Ptpn18 T C 1: 34,463,506 probably null Het
Rai14 T G 15: 10,571,548 K936N probably damaging Het
Rasgrf2 A G 13: 91,887,689 L1077P probably damaging Het
Rgn C A X: 20,550,457 Q27K probably benign Het
Ryr2 C T 13: 11,595,076 S723N probably benign Het
Scamp1 A G 13: 94,224,947 F142L possibly damaging Het
Selenon A G 4: 134,551,518 V67A probably benign Het
Slc5a5 T C 8: 70,889,435 I292V possibly damaging Het
Smarca2 C A 19: 26,676,740 T775K probably damaging Het
Stab1 C T 14: 31,139,830 V2437I possibly damaging Het
Tas2r143 C T 6: 42,400,383 A49V probably benign Het
Tlr7 T A X: 167,307,849 N214Y probably damaging Het
Unc13a C A 8: 71,651,221 D856Y probably damaging Het
Upp2 T C 2: 58,790,106 Y263H probably damaging Het
Vill T C 9: 119,063,347 S349P probably benign Het
Zfp644 T C 5: 106,637,470 probably null Het
Zfp664 T C 5: 124,886,153 C204R unknown Het
Zfp729b A G 13: 67,592,794 Y451H possibly damaging Het
Other mutations in Fads3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Fads3 APN 19 10052299 missense probably null 0.98
IGL00422:Fads3 APN 19 10055681 missense possibly damaging 0.80
IGL01081:Fads3 APN 19 10053002 missense probably benign 0.00
IGL02454:Fads3 APN 19 10055119 missense probably damaging 0.97
IGL02477:Fads3 APN 19 10056442 missense probably damaging 1.00
R0611:Fads3 UTSW 19 10041836 missense probably damaging 1.00
R1169:Fads3 UTSW 19 10054099 missense possibly damaging 0.82
R1893:Fads3 UTSW 19 10056504 missense probably benign
R2508:Fads3 UTSW 19 10056454 missense probably damaging 1.00
R3151:Fads3 UTSW 19 10057898 missense probably benign 0.01
R4543:Fads3 UTSW 19 10041811 missense possibly damaging 0.60
R4766:Fads3 UTSW 19 10056020 missense possibly damaging 0.94
R4823:Fads3 UTSW 19 10041888 missense probably damaging 0.98
R5117:Fads3 UTSW 19 10041958 critical splice donor site probably null
R5846:Fads3 UTSW 19 10053033 missense probably null 1.00
R6117:Fads3 UTSW 19 10054267 missense probably damaging 1.00
R6225:Fads3 UTSW 19 10041838 missense probably benign 0.25
X0027:Fads3 UTSW 19 10054250 missense probably damaging 1.00
Z1176:Fads3 UTSW 19 10041807 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- TCGTGTGGATCACGCAGATGAAC -3'
(R):5'- GTGAGGAAAGGCTTCACCTCGTAG -3'

Sequencing Primer
(F):5'- CAAGCTCTCAGGTAGGAACTG -3'
(R):5'- AAAGGCTTCACCTCGTAGTGTAG -3'
Posted On2014-03-14