Incidental Mutation 'R1430:Ubxn4'
ID161465
Institutional Source Beutler Lab
Gene Symbol Ubxn4
Ensembl Gene ENSMUSG00000026353
Gene NameUBX domain protein 4
SynonymsUbxd2, 1300013G12Rik
MMRRC Submission 039486-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.476) question?
Stock #R1430 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location128243964-128279378 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 128274880 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 420 (F420I)
Ref Sequence ENSEMBL: ENSMUSP00000027592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027592]
Predicted Effect probably benign
Transcript: ENSMUST00000027592
AA Change: F420I

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000027592
Gene: ENSMUSG00000026353
AA Change: F420I

DomainStartEndE-ValueType
coiled coil region 191 290 N/A INTRINSIC
UBX 309 393 5.63e-32 SMART
low complexity region 444 460 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187031
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189895
Meta Mutation Damage Score 0.1000 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.9%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UBXD2 is an integral membrane protein of the endoplasmic reticulum (ER) that binds valosin-containing protein (VCP; MIM 601023) and promotes ER-associated protein degradation (ERAD) (Liang et al., 2006 [PubMed 16968747]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam3 T A 8: 24,714,271 probably benign Het
Aoc2 A G 11: 101,326,495 Y468C probably damaging Het
Cdyl2 A G 8: 116,579,317 probably benign Het
Cfh A G 1: 140,102,698 probably benign Het
Cyp2j9 G T 4: 96,583,964 probably benign Het
Dapk1 T G 13: 60,754,143 F929V probably benign Het
Dhx9 A T 1: 153,483,747 M35K probably benign Het
Dnah5 G A 15: 28,345,857 E2448K probably benign Het
Doc2b A T 11: 75,780,155 C217S possibly damaging Het
Dock11 A G X: 36,069,912 I2010V probably benign Het
Dram1 T C 10: 88,324,779 T227A possibly damaging Het
Eppin G A 2: 164,589,403 T101M probably damaging Het
F13a1 T C 13: 36,898,131 D533G probably damaging Het
Fmo1 C A 1: 162,839,724 R174L probably damaging Het
Fsip2 C A 2: 82,998,063 L6735I possibly damaging Het
Gab1 G T 8: 80,788,612 T359K probably benign Het
Ggta1 T C 2: 35,408,017 D118G possibly damaging Het
Gramd1a A G 7: 31,132,786 S609P probably damaging Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Lama1 A G 17: 67,782,155 Y1607C possibly damaging Het
Lrrc24 G T 15: 76,723,792 probably null Het
Mak C A 13: 41,070,284 probably benign Het
Megf8 G A 7: 25,364,343 R2708Q possibly damaging Het
Mettl24 T C 10: 40,737,795 C177R probably damaging Het
Mgam G C 6: 40,756,371 E812D probably benign Het
Mroh8 T C 2: 157,269,525 R170G possibly damaging Het
Msn G A X: 96,152,719 V130I probably benign Het
Ncoa4 G A 14: 32,176,722 V500I probably benign Het
Olfr10 A G 11: 49,318,101 probably null Het
Olfr1087 T C 2: 86,690,522 Y151C possibly damaging Het
Olfr1440 C T 19: 12,394,437 T58I probably benign Het
Olfr170 A G 16: 19,606,002 L222P probably damaging Het
Ppm1h T C 10: 122,857,099 S302P probably damaging Het
Prkce T A 17: 86,559,137 probably benign Het
Psenen T C 7: 30,562,390 I34V probably benign Het
Rbl1 T C 2: 157,169,906 T710A probably benign Het
Sdk2 C T 11: 113,838,646 silent Het
Slc1a5 A G 7: 16,782,403 D168G probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Syce1 A T 7: 140,779,438 probably benign Het
Tbc1d23 G T 16: 57,214,210 D75E probably damaging Het
Tbk1 A G 10: 121,559,934 V418A probably benign Het
Tmem132e T C 11: 82,438,296 V467A probably damaging Het
Tmem241 T C 18: 11,993,594 D144G probably benign Het
Tsc2 A G 17: 24,599,023 probably null Het
Usp34 A G 11: 23,459,151 T2645A probably damaging Het
Utp14b A G 1: 78,666,394 K670E probably benign Het
Zfp407 C T 18: 84,209,455 V2010M probably benign Het
Zfp879 A G 11: 50,833,957 F91L probably benign Het
Zfyve26 A G 12: 79,282,817 S532P probably benign Het
Other mutations in Ubxn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00545:Ubxn4 APN 1 128259465 missense possibly damaging 0.90
IGL02302:Ubxn4 APN 1 128256111 intron probably benign
IGL03066:Ubxn4 APN 1 128260854 unclassified probably null
E0370:Ubxn4 UTSW 1 128262904 missense probably benign 0.23
P4748:Ubxn4 UTSW 1 128262904 missense probably benign 0.23
R0008:Ubxn4 UTSW 1 128262904 missense probably benign 0.23
R0086:Ubxn4 UTSW 1 128262904 missense probably benign 0.23
R0087:Ubxn4 UTSW 1 128262904 missense probably benign 0.23
R0220:Ubxn4 UTSW 1 128256194 missense possibly damaging 0.86
R0244:Ubxn4 UTSW 1 128262904 missense probably benign 0.23
R0464:Ubxn4 UTSW 1 128262904 missense probably benign 0.23
R0465:Ubxn4 UTSW 1 128262904 missense probably benign 0.23
R0466:Ubxn4 UTSW 1 128262904 missense probably benign 0.23
R0467:Ubxn4 UTSW 1 128262904 missense probably benign 0.23
R0658:Ubxn4 UTSW 1 128262904 missense probably benign 0.23
R1623:Ubxn4 UTSW 1 128272851 missense possibly damaging 0.62
R1700:Ubxn4 UTSW 1 128252286 missense possibly damaging 0.89
R1764:Ubxn4 UTSW 1 128256179 missense probably damaging 1.00
R2128:Ubxn4 UTSW 1 128244510 missense probably benign
R2472:Ubxn4 UTSW 1 128272869 missense probably damaging 1.00
R4610:Ubxn4 UTSW 1 128255449 missense probably benign 0.03
R4651:Ubxn4 UTSW 1 128274850 missense probably benign 0.32
R4652:Ubxn4 UTSW 1 128274850 missense probably benign 0.32
R4804:Ubxn4 UTSW 1 128266404 nonsense probably null
R5735:Ubxn4 UTSW 1 128258940 missense possibly damaging 0.83
R5826:Ubxn4 UTSW 1 128266321 missense possibly damaging 0.80
R5840:Ubxn4 UTSW 1 128259525 missense possibly damaging 0.92
R5883:Ubxn4 UTSW 1 128256130 missense probably damaging 1.00
R6637:Ubxn4 UTSW 1 128277087 missense probably damaging 1.00
R6827:Ubxn4 UTSW 1 128276977 missense probably benign
R7092:Ubxn4 UTSW 1 128252222 missense probably benign 0.29
R7449:Ubxn4 UTSW 1 128244543 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TTCATGGGCACTTGGGAAGACG -3'
(R):5'- GCAAAGTTGCTTTACTAGCACCAAGG -3'

Sequencing Primer
(F):5'- CTTGGCTTTGTTTCCAGATAAAAGG -3'
(R):5'- GATTAAAGAAACCACTGTATGTGACC -3'
Posted On2014-03-14