Incidental Mutation 'R1546:Ccdc38'
Institutional Source Beutler Lab
Gene Symbol Ccdc38
Ensembl Gene ENSMUSG00000036168
Gene Namecoiled-coil domain containing 38
MMRRC Submission 039585-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.208) question?
Stock #R1546 (G1)
Quality Score225
Status Not validated
Chromosomal Location93540632-93584327 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 93565879 bp
Amino Acid Change Isoleucine to Leucine at position 134 (I134L)
Ref Sequence ENSEMBL: ENSMUSP00000150407 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092215] [ENSMUST00000132214]
Predicted Effect probably benign
Transcript: ENSMUST00000092215
AA Change: I234L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000089860
Gene: ENSMUSG00000036168
AA Change: I234L

Pfam:DUF4200 112 230 4.4e-28 PFAM
low complexity region 280 289 N/A INTRINSIC
low complexity region 317 333 N/A INTRINSIC
coiled coil region 388 412 N/A INTRINSIC
coiled coil region 479 522 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128786
Predicted Effect probably benign
Transcript: ENSMUST00000132214
AA Change: I134L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik T C 4: 147,941,775 S251P probably damaging Het
4931409K22Rik A T 5: 24,555,428 probably null Het
4932438A13Rik T C 3: 36,870,056 V10A possibly damaging Het
Aaas C A 15: 102,346,718 R79L probably benign Het
Acap2 C A 16: 31,104,936 E657* probably null Het
Adgrg5 A T 8: 94,941,630 E441V probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
AY358078 C T 14: 51,820,419 probably null Het
Bco2 A G 9: 50,550,629 V25A possibly damaging Het
Carf T A 1: 60,126,036 probably null Het
Cgnl1 A G 9: 71,725,815 S85P probably benign Het
Ctsl A G 13: 64,367,879 V126A probably damaging Het
Cwc27 A C 13: 104,802,185 S206A probably damaging Het
D630045J12Rik A G 6: 38,190,655 I1004T probably damaging Het
Dgki A G 6: 37,050,203 V401A probably damaging Het
Dpp8 C T 9: 65,063,493 H545Y possibly damaging Het
Dpy19l1 A T 9: 24,475,384 C205S probably damaging Het
Enpp2 C T 15: 54,845,829 E797K probably benign Het
Ephb2 C T 4: 136,771,009 R253H probably damaging Het
Esrra T C 19: 6,920,297 T31A probably benign Het
Ewsr1 C A 11: 5,078,574 probably benign Het
Flt4 G T 11: 49,631,981 R475L probably benign Het
Gm13547 A G 2: 29,763,909 E138G possibly damaging Het
Gm572 A T 4: 148,666,819 R216S possibly damaging Het
Hapln2 T A 3: 88,024,097 Y37F probably benign Het
Hhla1 C T 15: 65,933,327 A369T probably benign Het
Hist1h2ae A G 13: 23,570,945 V55A probably damaging Het
Hmg20a T A 9: 56,467,401 F14I possibly damaging Het
Itga2 A T 13: 114,849,420 S940T possibly damaging Het
Kcnt2 A G 1: 140,431,378 N377S probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lhx6 A G 2: 36,091,037 S298P probably benign Het
Lrp2 C T 2: 69,502,610 G1521D probably damaging Het
Mogat2 A G 7: 99,232,559 W57R probably damaging Het
Ms4a3 T C 19: 11,632,907 N97S probably benign Het
Myo1a A G 10: 127,712,624 D380G probably damaging Het
Nufip2 T A 11: 77,691,606 D115E probably damaging Het
Ogn A T 13: 49,609,333 K50N probably benign Het
Olfr202 T C 16: 59,284,003 R165G probably damaging Het
Olfr250 A T 9: 38,367,548 M1L probably benign Het
Pde8b G A 13: 95,046,443 T269I probably damaging Het
Ppargc1b A T 18: 61,310,606 D495E probably damaging Het
Prdm16 C A 4: 154,528,660 K103N possibly damaging Het
Proc C T 18: 32,127,410 G221S probably damaging Het
Pxk A G 14: 8,164,091 N561S probably damaging Het
Rapgef5 A G 12: 117,647,101 N323S probably benign Het
Slc6a13 T G 6: 121,332,374 D281E possibly damaging Het
Slc8a1 T C 17: 81,648,247 Y454C probably damaging Het
Sntg2 C A 12: 30,288,296 L115F probably damaging Het
Spata13 A G 14: 60,756,408 D1103G probably damaging Het
Supv3l1 G A 10: 62,432,446 A540V probably benign Het
Tet1 A T 10: 62,812,910 D1914E probably damaging Het
Tmem30a A G 9: 79,771,288 *329Q probably null Het
Tspan5 A T 3: 138,898,341 L162F probably damaging Het
Ttn T A 2: 76,719,052 K31760N probably damaging Het
Tyr A T 7: 87,437,992 D437E probably benign Het
Ubr4 T A 4: 139,416,927 L1427* probably null Het
Utrn C A 10: 12,436,364 D616Y probably damaging Het
Vcan A G 13: 89,692,956 S1490P probably damaging Het
Vcl T A 14: 21,008,950 C545S probably damaging Het
Vmn2r4 C T 3: 64,406,888 G224D probably damaging Het
Vmn2r97 T A 17: 18,947,848 V788E probably damaging Het
Vrtn G A 12: 84,648,508 V11M probably damaging Het
Zbtb21 A T 16: 97,952,027 V380D probably damaging Het
Zcchc14 G A 8: 121,604,263 probably benign Het
Other mutations in Ccdc38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01306:Ccdc38 APN 10 93569935 critical splice donor site probably null
IGL01986:Ccdc38 APN 10 93579843 missense probably damaging 1.00
IGL02396:Ccdc38 APN 10 93574132 missense possibly damaging 0.61
IGL02568:Ccdc38 APN 10 93579823 missense probably damaging 1.00
ANU23:Ccdc38 UTSW 10 93569935 critical splice donor site probably null
R0004:Ccdc38 UTSW 10 93574102 missense probably damaging 1.00
R0194:Ccdc38 UTSW 10 93565912 nonsense probably null
R0371:Ccdc38 UTSW 10 93562812 nonsense probably null
R1374:Ccdc38 UTSW 10 93582434 splice site probably benign
R1388:Ccdc38 UTSW 10 93581840 splice site probably benign
R2377:Ccdc38 UTSW 10 93574035 missense probably damaging 1.00
R2419:Ccdc38 UTSW 10 93548975 missense probably benign 0.23
R3949:Ccdc38 UTSW 10 93550219 missense probably damaging 1.00
R5592:Ccdc38 UTSW 10 93550202 missense possibly damaging 0.58
R5652:Ccdc38 UTSW 10 93555586 splice site probably null
R5857:Ccdc38 UTSW 10 93562833 missense possibly damaging 0.67
R5918:Ccdc38 UTSW 10 93570886 nonsense probably null
R5919:Ccdc38 UTSW 10 93578838 missense possibly damaging 0.95
R6057:Ccdc38 UTSW 10 93581746 missense probably damaging 1.00
R6293:Ccdc38 UTSW 10 93562797 nonsense probably null
R7511:Ccdc38 UTSW 10 93562800 missense possibly damaging 0.92
R8006:Ccdc38 UTSW 10 93555586 splice site probably null
R8206:Ccdc38 UTSW 10 93563284 missense probably damaging 0.97
R8313:Ccdc38 UTSW 10 93563249 missense probably damaging 1.00
Z1177:Ccdc38 UTSW 10 93562876 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- acaccctcacacagacatac -3'
Posted On2014-04-13