Incidental Mutation 'R1860:Prkaca'
ID203808
Institutional Source Beutler Lab
Gene Symbol Prkaca
Ensembl Gene ENSMUSG00000005469
Gene Nameprotein kinase, cAMP dependent, catalytic, alpha
SynonymsPkaca, C alpha, PKA, Cs
MMRRC Submission 039883-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.562) question?
Stock #R1860 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location83972993-83996443 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83981223 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 46 (S46P)
Ref Sequence ENSEMBL: ENSMUSP00000147256 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005606] [ENSMUST00000211558]
Predicted Effect probably benign
Transcript: ENSMUST00000005606
AA Change: S54P

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000005606
Gene: ENSMUSG00000005469
AA Change: S54P

DomainStartEndE-ValueType
S_TKc 44 298 2e-107 SMART
S_TK_X 299 344 3.7e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000211558
AA Change: S46P

PolyPhen 2 Score 0.106 (Sensitivity: 0.93; Specificity: 0.86)
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the serine/threonine protein kinase family. The holoenzyme, protein kinase A (also known as cyclic-AMP dependent protein kinase), mediates cellular response to changes in cyclic-AMP levels. This gene encodes the alpha catalytic subunit of protein kinase A. Protein kinase A-mediated signaling is transduced via phosphorylation of target proteins, and is important for many cellular functions, including mammalian sperm maturation and motility. Alternative splicing results in multiple transcript variants. A pseudogene of this gene has been defined on the X chromosome. [provided by RefSeq, Apr 2013]
PHENOTYPE: Homozygous mutant mice are highly susceptible to perinatal lethality. Surviving mice are runted and while spermatogenesis progresses normally, mature sperm shows impaired motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A G 5: 109,736,232 C587R probably damaging Het
Abca16 T A 7: 120,534,763 S1320T probably benign Het
Abra C A 15: 41,869,034 R212L probably damaging Het
Acadsb T A 7: 131,444,229 probably null Het
Adam26a A G 8: 43,569,541 V304A possibly damaging Het
Adgre1 T C 17: 57,441,363 V521A probably benign Het
Adh5 G A 3: 138,453,778 V288I probably benign Het
Astn1 A C 1: 158,601,945 N753T probably damaging Het
Atad2 A T 15: 58,096,718 probably null Het
Best3 A G 10: 116,993,273 T153A probably damaging Het
Ccdc122 G A 14: 77,111,407 V226I probably damaging Het
Ccdc175 T C 12: 72,105,926 Q735R probably benign Het
Cd19 T A 7: 126,409,641 I499F probably damaging Het
Cftr T A 6: 18,268,289 L749H probably benign Het
Clec2h G T 6: 128,675,827 G186W probably damaging Het
Cpsf3 T A 12: 21,296,732 I202N probably damaging Het
Crebbp G T 16: 4,087,736 T1669N possibly damaging Het
Csmd3 A T 15: 47,659,192 C2694S probably damaging Het
Cul4a G A 8: 13,123,565 R204Q probably damaging Het
D230025D16Rik A G 8: 105,240,071 E150G probably null Het
Derl2 A G 11: 71,018,343 F43S probably damaging Het
Dnah14 T A 1: 181,763,960 N3348K probably damaging Het
Dnhd1 T C 7: 105,704,205 V2855A probably benign Het
Dpysl4 G T 7: 139,090,299 C27F probably benign Het
Fam228b G A 12: 4,748,314 A163V probably damaging Het
Fscn1 T C 5: 142,970,063 probably null Het
Fzd5 C A 1: 64,734,994 R536L probably damaging Het
Gm8180 T A 14: 43,783,739 H4L probably benign Het
Gpr176 T A 2: 118,373,178 N4Y probably damaging Het
Grin3a T C 4: 49,665,309 I1109V possibly damaging Het
H2afy A G 13: 56,083,204 L287P probably damaging Het
Hcar1 T A 5: 123,879,029 I200F probably damaging Het
Heatr4 G A 12: 83,979,728 Q252* probably null Het
Hps1 G A 19: 42,762,449 H371Y probably damaging Het
Ikzf2 T C 1: 69,570,502 T195A probably damaging Het
Kdm1b G A 13: 47,049,190 A34T probably benign Het
Lef1 A G 3: 131,111,641 N57S probably damaging Het
Ltn1 A T 16: 87,416,343 D443E probably benign Het
Mamdc2 T C 19: 23,359,153 T331A probably damaging Het
March10 A T 11: 105,397,078 S133T probably damaging Het
Mb A G 15: 77,017,584 Y104H probably damaging Het
Mrc1 C A 2: 14,328,579 P1357Q probably benign Het
Nfib C T 4: 82,323,680 V425M probably damaging Het
Olfr1197 T G 2: 88,729,330 I90L probably damaging Het
Olfr1262 G A 2: 90,003,146 V247I probably benign Het
Olfr1272 C A 2: 90,282,158 C139F probably damaging Het
Olfr1467 T A 19: 13,365,341 S238T possibly damaging Het
Olfr473 A G 7: 107,934,390 Y290C probably damaging Het
Olfr527 G A 7: 140,336,219 R119H possibly damaging Het
Olfr654 T C 7: 104,587,905 S34P probably damaging Het
Olfr732 A T 14: 50,281,391 Y287* probably null Het
Olfr784 T C 10: 129,388,086 F151S probably damaging Het
Olfr916 A T 9: 38,658,365 V9E probably damaging Het
Piezo1 T C 8: 122,495,750 N919S possibly damaging Het
Prkcb T G 7: 122,568,201 V378G probably damaging Het
Ptprf A T 4: 118,223,932 L576Q probably damaging Het
Rapgef4 T C 2: 72,234,720 V687A probably benign Het
Rsad2 C T 12: 26,450,617 V224I probably damaging Het
Ryr1 A T 7: 29,009,552 D4796E unknown Het
Scn1a C T 2: 66,317,982 S1073N probably damaging Het
Slc26a3 A G 12: 31,465,846 M582V probably benign Het
Tbc1d32 A T 10: 56,123,537 Y846* probably null Het
Tbk1 A T 10: 121,547,171 M719K probably benign Het
Timeless A G 10: 128,246,114 K536R probably benign Het
Tle6 G T 10: 81,594,329 Q330K probably damaging Het
Tmem208 A G 8: 105,334,806 K155E possibly damaging Het
Toe1 T C 4: 116,805,229 Y273C probably damaging Het
Tppp2 A C 14: 51,920,605 N169T probably benign Het
Ttll6 T A 11: 96,138,874 Y204* probably null Het
Ubxn11 G A 4: 134,124,838 S32N probably damaging Het
Usp8 G A 2: 126,756,040 C961Y probably damaging Het
Vdac3 A T 8: 22,580,499 I132K possibly damaging Het
Vmn2r124 G T 17: 18,049,497 W5L probably benign Het
Vmn2r71 A T 7: 85,615,574 D38V probably damaging Het
Vmn2r87 C T 10: 130,479,886 V104I probably benign Het
Vmn2r97 C T 17: 18,947,386 T634I probably benign Het
Vps50 T C 6: 3,520,279 probably null Het
Wwc2 T C 8: 47,990,102 N32S possibly damaging Het
Ythdc2 T A 18: 44,872,956 I1172K possibly damaging Het
Zfp14 C T 7: 30,038,691 V290M probably damaging Het
Zfp317 G A 9: 19,641,984 A18T possibly damaging Het
Zfp354b A T 11: 50,923,542 N185K probably benign Het
Zscan21 T A 5: 138,126,630 D269E probably benign Het
Other mutations in Prkaca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01832:Prkaca APN 8 83990737 missense probably damaging 1.00
IGL02011:Prkaca APN 8 83990936 missense probably damaging 1.00
IGL03022:Prkaca APN 8 83995347 missense possibly damaging 0.56
IGL03038:Prkaca APN 8 83994951 missense probably benign
IGL03236:Prkaca APN 8 83990445 missense probably damaging 1.00
R0013:Prkaca UTSW 8 83988303 missense possibly damaging 0.64
R0458:Prkaca UTSW 8 83995282 splice site probably benign
R1693:Prkaca UTSW 8 83981198 missense probably benign
R1827:Prkaca UTSW 8 83990987 critical splice donor site probably null
R1955:Prkaca UTSW 8 83988317 missense probably damaging 0.97
R4084:Prkaca UTSW 8 83995310 missense probably damaging 1.00
R4770:Prkaca UTSW 8 83990870 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AAGAATGTCCCCTGGGTCATC -3'
(R):5'- ACCTTTCTAAAACCTGAGGTGC -3'

Sequencing Primer
(F):5'- GTCCCCTGGGTCATCTCCAC -3'
(R):5'- GAGGTTTGCACTGCTAATTTACAG -3'
Posted On2014-06-23