Incidental Mutation 'R7867:Prkaca'
ID607848
Institutional Source Beutler Lab
Gene Symbol Prkaca
Ensembl Gene ENSMUSG00000005469
Gene Nameprotein kinase, cAMP dependent, catalytic, alpha
SynonymsPkaca, C alpha, PKA, Cs
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.572) question?
Stock #R7867 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location83972993-83996443 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 83995334 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 325 (T325S)
Ref Sequence ENSEMBL: ENSMUSP00000005606 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005606] [ENSMUST00000095228] [ENSMUST00000211558]
PDB Structure
2.0 ANGSTROM REFINED CRYSTAL STRUCTURE OF THE CATALYTIC SUBUNIT OF CAMP-DEPENDENT PROTEIN KINASE COMPLEXED WITH A PEPTIDE INHIBITOR AND DETERGENT [X-RAY DIFFRACTION]
2.2 angstrom refined crystal structure of the catalytic subunit of cAMP-dependent protein kinase complexed with MNATP and a peptide inhibitor [X-RAY DIFFRACTION]
A BINARY COMPLEX OF THE CATALYTIC SUBUNIT OF CAMP-DEPENDENT PROTEIN KINASE AND ADENOSINE FURTHER DEFINES CONFORMATIONAL FLEXIBILITY [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE POTENT NATURAL PRODUCT INHIBITOR BALANOL IN COMPLEX WITH THE CATALYTIC SUBUNIT OF CAMP-DEPENDENT PROTEIN KINASE [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF A POLYHISTIDINE-TAGGED RECOMBINANT CATALYTIC SUBUNIT OF CAMP-DEPENDENT PROTEIN KINASE COMPLEXED WITH THE PEPTIDE INHIBITOR PKI(5-24) AND ADENOSINE [X-RAY DIFFRACTION]
Crystal structure of apoenzyme cAMP-dependent protein kinase catalytic subunit [X-RAY DIFFRACTION]
Crystal Structure of the Catalytic Subunit of cAMP-dependent Protein Kinase Complexed with a Substrate Peptide, ADP and Detergent [X-RAY DIFFRACTION]
Crystal Structure of the Catalytic Subunit of cAMP-dependent Protein Kinase Complexed with a Phosphorylated Substrate Peptide and Detergent [X-RAY DIFFRACTION]
Crystal Structure of a Transition State Mimic of the Catalytic Subunit of cAMP-dependent Protein Kinase [X-RAY DIFFRACTION]
[]
>> 51 additional structures at PDB <<
Predicted Effect probably benign
Transcript: ENSMUST00000005606
AA Change: T325S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000005606
Gene: ENSMUSG00000005469
AA Change: T325S

DomainStartEndE-ValueType
S_TKc 44 298 2e-107 SMART
S_TK_X 299 344 3.7e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095228
SMART Domains Protein: ENSMUSP00000092853
Gene: ENSMUSG00000079003

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
low complexity region 100 230 N/A INTRINSIC
low complexity region 256 277 N/A INTRINSIC
low complexity region 278 301 N/A INTRINSIC
low complexity region 302 323 N/A INTRINSIC
low complexity region 402 423 N/A INTRINSIC
SAM 440 506 2.91e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000210523
Predicted Effect probably benign
Transcript: ENSMUST00000211558
AA Change: T317S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the serine/threonine protein kinase family. The holoenzyme, protein kinase A (also known as cyclic-AMP dependent protein kinase), mediates cellular response to changes in cyclic-AMP levels. This gene encodes the alpha catalytic subunit of protein kinase A. Protein kinase A-mediated signaling is transduced via phosphorylation of target proteins, and is important for many cellular functions, including mammalian sperm maturation and motility. Alternative splicing results in multiple transcript variants. A pseudogene of this gene has been defined on the X chromosome. [provided by RefSeq, Apr 2013]
PHENOTYPE: Homozygous mutant mice are highly susceptible to perinatal lethality. Surviving mice are runted and while spermatogenesis progresses normally, mature sperm shows impaired motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,262,139 probably null Het
Abcf1 C A 17: 35,961,998 K252N probably damaging Het
Abi3 C T 11: 95,834,025 A211T possibly damaging Het
Acaca A T 11: 84,249,524 D608V possibly damaging Het
Akap10 A G 11: 61,900,446 Y396H probably damaging Het
Ap3b1 C G 13: 94,483,263 S778W unknown Het
Baat G A 4: 49,502,925 L66F probably benign Het
Cachd1 A G 4: 100,988,562 N981S probably damaging Het
Cacna1c C T 6: 118,776,446 R243H Het
Cdh23 T A 10: 60,314,611 I2527F probably damaging Het
Cinp A G 12: 110,874,123 V198A probably benign Het
Clec4d T C 6: 123,267,164 probably null Het
Cnn3 A G 3: 121,455,055 I204V probably benign Het
Cpxm2 C A 7: 132,049,071 G620V probably damaging Het
Ctrl A C 8: 105,932,865 S93A probably benign Het
Cyp2d34 A G 15: 82,617,224 V301A possibly damaging Het
Dnaaf5 G T 5: 139,161,810 K376N probably damaging Het
Eno2 C T 6: 124,763,174 D300N probably damaging Het
Fam117b T A 1: 59,974,887 N440K probably damaging Het
Fam131a A G 16: 20,695,834 S62G probably benign Het
Fam172a T C 13: 77,902,718 M165T probably benign Het
Fam189b T A 3: 89,185,776 Y280* probably null Het
Fancm T A 12: 65,116,466 probably null Het
Fancm A G 12: 65,118,399 D1506G probably benign Het
Fhad1 C A 4: 141,905,591 V1201L probably benign Het
Gdpd4 T A 7: 97,973,978 C265* probably null Het
Gm3127 A T 14: 4,166,115 T98S probably null Het
Gm4778 G C 3: 94,265,847 S50T probably benign Het
Gpsm1 A T 2: 26,340,436 D466V probably benign Het
Gramd1a T G 7: 31,143,567 K76Q probably damaging Het
Gstp3 T C 19: 4,058,808 D24G probably damaging Het
Kalrn G A 16: 33,989,791 T2531I possibly damaging Het
Klk7 C A 7: 43,812,909 D108E probably damaging Het
Klkb1 A G 8: 45,286,965 S97P probably damaging Het
Krt13 T C 11: 100,121,182 D105G probably damaging Het
Lingo2 T A 4: 35,709,302 H226L probably benign Het
Lrba T C 3: 86,368,589 S1755P probably damaging Het
Marf1 A G 16: 14,128,606 V1217A probably damaging Het
Mtss1 A T 15: 58,971,009 V118E possibly damaging Het
Mug1 T A 6: 121,873,634 D696E probably benign Het
Ndufa3 C T 7: 3,620,004 P56L probably damaging Het
Nop56 T A 2: 130,278,285 C471S possibly damaging Het
Obscn T A 11: 59,000,826 H6960L unknown Het
Olfr535 C T 7: 140,493,136 T166I probably benign Het
Pcdhb10 A C 18: 37,413,566 Q565P probably benign Het
Pde6g T A 11: 120,448,127 H79L possibly damaging Het
Phrf1 G T 7: 141,256,611 M265I unknown Het
Pkd2 T C 5: 104,483,120 F470S probably damaging Het
Plekhm1 T A 11: 103,380,327 D446V probably damaging Het
Proz A T 8: 13,061,027 probably benign Het
Pten T C 19: 32,815,494 F238L probably benign Het
Ptpn21 G A 12: 98,705,176 L198F probably damaging Het
Rbm5 A T 9: 107,751,731 S394T probably benign Het
Scaf8 T G 17: 3,177,719 S408A unknown Het
Slc41a3 T A 6: 90,640,927 F312I probably damaging Het
Soat2 T A 15: 102,151,163 probably null Het
Sorcs1 C A 19: 50,230,260 G595* probably null Het
Stox1 G T 10: 62,664,944 D612E probably benign Het
Suco T C 1: 161,837,796 I530M possibly damaging Het
Syne2 A G 12: 75,983,727 probably null Het
Thbd G A 2: 148,407,744 A68V probably damaging Het
Tmem109 A T 19: 10,878,102 M4K unknown Het
Tmub1 G C 5: 24,446,666 P85R possibly damaging Het
Tnk2 A C 16: 32,681,235 Q1039H probably damaging Het
Tpm3 T C 3: 90,086,468 L89S probably damaging Het
Unc13b C T 4: 43,232,573 R432* probably null Het
Vmn2r59 T A 7: 42,012,283 I703F probably damaging Het
Xylt1 T A 7: 117,475,514 I122N probably benign Het
Zc3h12c T C 9: 52,143,948 E187G probably damaging Het
Other mutations in Prkaca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01832:Prkaca APN 8 83990737 missense probably damaging 1.00
IGL02011:Prkaca APN 8 83990936 missense probably damaging 1.00
IGL03022:Prkaca APN 8 83995347 missense possibly damaging 0.56
IGL03038:Prkaca APN 8 83994951 missense probably benign
IGL03236:Prkaca APN 8 83990445 missense probably damaging 1.00
R0013:Prkaca UTSW 8 83988303 missense possibly damaging 0.64
R0458:Prkaca UTSW 8 83995282 splice site probably benign
R1693:Prkaca UTSW 8 83981198 missense probably benign
R1827:Prkaca UTSW 8 83990987 critical splice donor site probably null
R1860:Prkaca UTSW 8 83981223 missense probably benign 0.11
R1955:Prkaca UTSW 8 83988317 missense probably damaging 0.97
R4084:Prkaca UTSW 8 83995310 missense probably damaging 1.00
R4770:Prkaca UTSW 8 83990870 missense probably benign 0.05
R7887:Prkaca UTSW 8 83986895 missense probably benign 0.07
R8313:Prkaca UTSW 8 83990522 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTCCATTTGATAAGTTGGGTTGC -3'
(R):5'- AGATGCATGGAACTCTAGGGC -3'

Sequencing Primer
(F):5'- CAGAGAAGACCTTAATGTTGAGCTC -3'
(R):5'- ATGGAACTCTAGGGCCCTCTG -3'
Posted On2019-12-20