Incidental Mutation 'R1898:Zfp319'
ID212127
Institutional Source Beutler Lab
Gene Symbol Zfp319
Ensembl Gene ENSMUSG00000046556
Gene Namezinc finger protein 319
Synonyms
MMRRC Submission 039918-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R1898 (G1)
Quality Score203
Status Not validated
Chromosome8
Chromosomal Location95323011-95331950 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 95328789 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 262 (C262F)
Ref Sequence ENSEMBL: ENSMUSP00000053397 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034245] [ENSMUST00000057717] [ENSMUST00000126180] [ENSMUST00000162294] [ENSMUST00000213059]
Predicted Effect probably benign
Transcript: ENSMUST00000034245
SMART Domains Protein: ENSMUSP00000034245
Gene: ENSMUSG00000031792

DomainStartEndE-ValueType
Pfam:HVSL 45 265 6.3e-70 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000057717
AA Change: C262F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053397
Gene: ENSMUSG00000046556
AA Change: C262F

DomainStartEndE-ValueType
low complexity region 6 29 N/A INTRINSIC
low complexity region 53 64 N/A INTRINSIC
Blast:ZnF_C2H2 75 99 6e-7 BLAST
ZnF_C2H2 103 123 7.57e1 SMART
ZnF_C2H2 131 153 8.67e-1 SMART
low complexity region 168 189 N/A INTRINSIC
ZnF_C2H2 201 223 9.73e-4 SMART
ZnF_C2H2 229 251 1.47e-3 SMART
ZnF_C2H2 257 279 1.12e-3 SMART
ZnF_C2H2 314 336 6.42e-4 SMART
ZnF_C2H2 342 364 1.2e-3 SMART
ZnF_C2H2 370 392 8.81e-2 SMART
ZnF_C2H2 398 418 2.75e1 SMART
ZnF_C2H2 427 449 1.84e-4 SMART
ZnF_C2H2 457 477 1.27e2 SMART
ZnF_C2H2 485 507 2.79e-4 SMART
ZnF_C2H2 513 535 6.42e-4 SMART
ZnF_C2H2 541 563 4.11e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126180
SMART Domains Protein: ENSMUSP00000122529
Gene: ENSMUSG00000031792

DomainStartEndE-ValueType
Pfam:HVSL 1 113 6.4e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145060
Predicted Effect probably benign
Transcript: ENSMUST00000153991
Predicted Effect probably benign
Transcript: ENSMUST00000162294
Predicted Effect probably benign
Transcript: ENSMUST00000213059
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.3%
  • 20x: 92.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,735,132 N789S possibly damaging Het
Abca1 C A 4: 53,071,977 R1195L probably benign Het
Abca14 A G 7: 120,251,169 Y748C probably damaging Het
Abca6 A G 11: 110,208,799 F974S probably damaging Het
Acyp1 T C 12: 85,288,340 K2E probably benign Het
Ahcy T A 2: 155,062,253 S355C probably benign Het
AI182371 A G 2: 35,100,649 V12A probably damaging Het
Ankrd36 T C 11: 5,575,683 I215T probably benign Het
Aox1 C T 1: 58,078,442 R828C probably damaging Het
Atp1a4 T A 1: 172,235,048 I631F probably damaging Het
Brinp3 T G 1: 146,901,249 V478G possibly damaging Het
Cadm2 G A 16: 66,815,383 S106L probably damaging Het
Celf2 C T 2: 6,604,164 V95M probably damaging Het
Chka A T 19: 3,892,205 E404D probably damaging Het
Clec5a A C 6: 40,581,936 V72G probably benign Het
Cnn1 T C 9: 22,101,264 probably null Het
Coq6 A G 12: 84,366,963 E89G probably benign Het
Cpne6 A T 14: 55,517,028 I538F possibly damaging Het
Crx G A 7: 15,868,223 P177S probably damaging Het
Cysltr2 G T 14: 73,029,533 P246T probably damaging Het
Decr1 A G 4: 15,929,801 I164T probably damaging Het
Dmtf1 A T 5: 9,128,091 V315E probably damaging Het
Dnah7b A G 1: 46,236,714 N2587S probably benign Het
E2f6 C A 12: 16,824,580 T221K probably benign Het
Fat3 T G 9: 15,960,130 D3655A probably damaging Het
Fbxw28 G A 9: 109,323,384 T384I probably benign Het
Fes T A 7: 80,379,911 I608F probably damaging Het
Flnc G A 6: 29,438,666 W186* probably null Het
Gabrb2 A G 11: 42,593,832 K239E possibly damaging Het
Gen1 T C 12: 11,241,608 R727G probably benign Het
Glb1 T A 9: 114,424,035 V184E probably damaging Het
Gngt1 A T 6: 3,996,724 I57F possibly damaging Het
Ice1 T C 13: 70,602,307 I87V possibly damaging Het
Itih1 A G 14: 30,932,287 Y674H probably benign Het
Itsn1 T A 16: 91,899,580 C24S probably damaging Het
Loxl1 A G 9: 58,297,678 V418A probably damaging Het
Myh10 A G 11: 68,771,906 N595S probably damaging Het
Myo5c C T 9: 75,297,626 T1587I probably damaging Het
Npat T A 9: 53,563,637 F910I probably damaging Het
Nradd T C 9: 110,621,608 Y167C probably damaging Het
Nt5dc1 T C 10: 34,313,635 E352G probably benign Het
Numa1 T C 7: 101,992,720 probably null Het
Odc1 T A 12: 17,548,841 S241T probably damaging Het
Olfr128 A T 17: 37,923,625 N20Y possibly damaging Het
Olfr744 A T 14: 50,618,774 D184V probably damaging Het
Pcnx3 T C 19: 5,672,587 D951G probably damaging Het
Pigg T C 5: 108,336,542 F685L probably benign Het
Pnpla7 T A 2: 25,053,784 probably benign Het
Pramef25 C T 4: 143,950,728 V94M probably damaging Het
Rcsd1 C T 1: 165,659,429 A72T probably benign Het
Rp1l1 A T 14: 64,031,590 T1542S probably benign Het
Sct A T 7: 141,278,848 L57Q probably damaging Het
Serpinb3b T C 1: 107,154,587 S316G possibly damaging Het
Shprh T C 10: 11,186,869 L1240S probably damaging Het
Slc4a1 C T 11: 102,350,307 E924K probably damaging Het
Sp7 A T 15: 102,359,018 Y118N possibly damaging Het
Srebf2 A G 15: 82,203,735 T219A probably damaging Het
Tenm3 G T 8: 48,310,761 P753T probably damaging Het
Tonsl A T 15: 76,638,853 probably null Het
Trio A T 15: 27,742,380 S2675T possibly damaging Het
Tspan12 T C 6: 21,795,694 T166A probably damaging Het
Ttll4 A G 1: 74,697,482 D1122G probably benign Het
Vmn1r77 G A 7: 12,041,623 A41T probably damaging Het
Xpo7 A T 14: 70,695,624 F276Y probably benign Het
Zdhhc1 A T 8: 105,478,746 probably null Het
Zfp442 C T 2: 150,408,662 C383Y probably damaging Het
Zfp57 G T 17: 37,009,758 R168L possibly damaging Het
Other mutations in Zfp319
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01611:Zfp319 APN 8 95328912 missense probably benign 0.11
IGL02478:Zfp319 APN 8 95329093 missense possibly damaging 0.95
IGL02563:Zfp319 APN 8 95323734 unclassified probably benign
IGL02622:Zfp319 APN 8 95328961 missense probably damaging 0.97
IGL02945:Zfp319 APN 8 95323818 unclassified probably benign
Lanky UTSW 8 95328105 frame shift probably null
R0894:Zfp319 UTSW 8 95329622 unclassified probably benign
R1937:Zfp319 UTSW 8 95328571 missense probably damaging 1.00
R2127:Zfp319 UTSW 8 95323763 unclassified probably benign
R2157:Zfp319 UTSW 8 95328031 missense probably damaging 1.00
R2256:Zfp319 UTSW 8 95328501 missense possibly damaging 0.47
R3547:Zfp319 UTSW 8 95328817 missense probably damaging 0.96
R4665:Zfp319 UTSW 8 95325573 unclassified probably benign
R5174:Zfp319 UTSW 8 95328169 unclassified probably null
R5249:Zfp319 UTSW 8 95328471 missense probably benign 0.00
R5478:Zfp319 UTSW 8 95325565 unclassified probably benign
R5623:Zfp319 UTSW 8 95325571 unclassified probably benign
R6165:Zfp319 UTSW 8 95328105 frame shift probably null
R7175:Zfp319 UTSW 8 95328782 missense probably damaging 1.00
R7271:Zfp319 UTSW 8 95331843 unclassified probably benign
R8303:Zfp319 UTSW 8 95329137 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATCACACTTGAAGGGCCTC -3'
(R):5'- TTTGCCAGAAGCCCTTCAAG -3'

Sequencing Primer
(F):5'- ACTGTGCGTGCGCTCATG -3'
(R):5'- TTCAAGCACCTGTCGGAGC -3'
Posted On2014-06-30