Incidental Mutation 'R0007:Slc44a4'
ID212469
Institutional Source Beutler Lab
Gene Symbol Slc44a4
Ensembl Gene ENSMUSG00000007034
Gene Namesolute carrier family 44, member 4
Synonyms2210409B01Rik, NG22
MMRRC Submission 038302-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0007 (G1)
Quality Score75
Status Validated
Chromosome17
Chromosomal Location34914466-34930436 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 34921254 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 60 (A60T)
Ref Sequence ENSEMBL: ENSMUSP00000132965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007249] [ENSMUST00000169230]
Predicted Effect probably damaging
Transcript: ENSMUST00000007249
AA Change: A212T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000007249
Gene: ENSMUSG00000007034
AA Change: A212T

DomainStartEndE-ValueType
transmembrane domain 34 56 N/A INTRINSIC
low complexity region 93 102 N/A INTRINSIC
transmembrane domain 226 248 N/A INTRINSIC
transmembrane domain 250 272 N/A INTRINSIC
Pfam:Choline_transpo 311 674 5.4e-119 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000169230
AA Change: A60T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000132965
Gene: ENSMUSG00000007034
AA Change: A60T

DomainStartEndE-ValueType
transmembrane domain 74 96 N/A INTRINSIC
transmembrane domain 98 120 N/A INTRINSIC
Pfam:Choline_transpo 157 524 3.9e-129 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173664
Meta Mutation Damage Score 0.1482 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.5%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene may be a sodium-dependent transmembrane transport protein involved in the uptake of choline by cholinergic neurons. Defects in this gene can cause sialidosis, a lysosomal storage disease. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 A T 17: 35,959,670 Y543N probably damaging Het
Adgrb3 C A 1: 25,111,691 probably null Het
AI504432 T A 3: 107,048,836 noncoding transcript Het
Cd82 T C 2: 93,433,881 N39S probably benign Het
Cntnap2 A C 6: 45,992,073 N250H possibly damaging Het
Col7a1 T C 9: 108,961,403 V973A unknown Het
Cyp2c66 T A 19: 39,170,958 C284* probably null Het
Denr T A 5: 123,924,814 Y127N probably damaging Het
Diaph3 C A 14: 86,866,620 R776L possibly damaging Het
Gm5600 T A 7: 113,707,773 noncoding transcript Het
Hephl1 A T 9: 15,086,175 D398E possibly damaging Het
Lama3 T A 18: 12,497,881 probably benign Het
Mtrr A T 13: 68,575,330 F154L probably benign Het
Myo1b T A 1: 51,776,254 R650S probably damaging Het
Nek10 T A 14: 14,840,574 H153Q probably benign Het
Nelfe A G 17: 34,853,986 probably benign Het
Nlrp9a T C 7: 26,551,090 probably benign Het
Nos1 T C 5: 117,910,088 S653P probably damaging Het
Olfr502 A G 7: 108,523,213 S246P probably damaging Het
Olfr888 A T 9: 38,109,094 Y131F possibly damaging Het
Pcsk5 C A 19: 17,654,861 G314C probably damaging Het
Ralgps1 A G 2: 33,143,389 S393P probably damaging Het
Slc4a4 G A 5: 89,038,578 D173N probably damaging Het
Sparcl1 T A 5: 104,087,080 Q523L probably damaging Het
Srgap3 A G 6: 112,829,512 Y63H probably damaging Het
Trim16 A G 11: 62,829,118 M84V probably benign Het
Trpm3 G A 19: 22,987,529 A1453T probably benign Het
Ttn C T 2: 76,880,204 probably benign Het
Other mutations in Slc44a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Slc44a4 APN 17 34930240 utr 3 prime probably benign
IGL01097:Slc44a4 APN 17 34921569 missense probably damaging 0.97
IGL01296:Slc44a4 APN 17 34921698 missense probably benign 0.39
IGL01606:Slc44a4 APN 17 34929018 missense probably damaging 1.00
IGL01759:Slc44a4 APN 17 34921243 missense probably benign 0.00
IGL02026:Slc44a4 APN 17 34921856 splice site probably benign
IGL02119:Slc44a4 APN 17 34928661 missense probably damaging 1.00
IGL02338:Slc44a4 APN 17 34923810 missense possibly damaging 0.90
IGL02383:Slc44a4 APN 17 34927710 missense probably benign 0.00
IGL02526:Slc44a4 APN 17 34928487 missense probably damaging 0.99
IGL02744:Slc44a4 APN 17 34927800 missense probably damaging 1.00
IGL02754:Slc44a4 APN 17 34921303 missense probably damaging 0.98
ANU74:Slc44a4 UTSW 17 34921578 missense probably damaging 1.00
PIT4142001:Slc44a4 UTSW 17 34921275 missense probably damaging 0.99
R0007:Slc44a4 UTSW 17 34921254 missense probably damaging 0.99
R0452:Slc44a4 UTSW 17 34928095 missense possibly damaging 0.82
R0894:Slc44a4 UTSW 17 34928490 missense possibly damaging 0.92
R1136:Slc44a4 UTSW 17 34928022 missense probably damaging 1.00
R1224:Slc44a4 UTSW 17 34921868 missense probably benign 0.18
R1779:Slc44a4 UTSW 17 34921925 missense probably damaging 1.00
R2679:Slc44a4 UTSW 17 34923423 splice site probably benign
R3499:Slc44a4 UTSW 17 34921680 missense probably benign 0.02
R3732:Slc44a4 UTSW 17 34921561 synonymous silent
R4084:Slc44a4 UTSW 17 34917347 missense probably damaging 1.00
R4197:Slc44a4 UTSW 17 34918252 missense probably benign 0.12
R4536:Slc44a4 UTSW 17 34923839 missense probably damaging 1.00
R4547:Slc44a4 UTSW 17 34927755 missense probably damaging 1.00
R5093:Slc44a4 UTSW 17 34921243 missense probably benign 0.00
R6005:Slc44a4 UTSW 17 34923454 missense possibly damaging 0.69
R6396:Slc44a4 UTSW 17 34928884 nonsense probably null
R6660:Slc44a4 UTSW 17 34930225 missense probably damaging 0.99
R6860:Slc44a4 UTSW 17 34921068 missense probably damaging 1.00
R6863:Slc44a4 UTSW 17 34923822 missense probably benign 0.41
R6947:Slc44a4 UTSW 17 34928068 missense probably null 1.00
R7250:Slc44a4 UTSW 17 34918544 critical splice donor site probably null
R7297:Slc44a4 UTSW 17 34927912 missense probably damaging 0.98
R7425:Slc44a4 UTSW 17 34921691 missense possibly damaging 0.94
R7696:Slc44a4 UTSW 17 34928700 missense probably damaging 1.00
R7871:Slc44a4 UTSW 17 34923852 critical splice donor site probably null
R7954:Slc44a4 UTSW 17 34923852 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TACATCCTGGCAGCGTTCTCAGAC -3'
(R):5'- GCACCCACAGGTATTCGTAGATTCG -3'

Sequencing Primer
(F):5'- GAGGGTCAGATAGACTCCCAC -3'
(R):5'- GATTCGACTCATCTTCTAAGAGGC -3'
Posted On2014-07-03