Incidental Mutation 'Y4335:Hsh2d'
ID226075
Institutional Source Beutler Lab
Gene Symbol Hsh2d
Ensembl Gene ENSMUSG00000062007
Gene Namehematopoietic SH2 domain containing
SynonymsALX, Hsh2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #Y4335 ()
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location72189638-72201527 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 72200460 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 229 (D229N)
Ref Sequence ENSEMBL: ENSMUSP00000127575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072097] [ENSMUST00000098630] [ENSMUST00000165324]
Predicted Effect probably benign
Transcript: ENSMUST00000072097
AA Change: D229N

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000071970
Gene: ENSMUSG00000062007
AA Change: D229N

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
SH2 32 115 1.75e-23 SMART
low complexity region 320 329 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098630
SMART Domains Protein: ENSMUSP00000096231
Gene: ENSMUSG00000074240

DomainStartEndE-ValueType
EFh 43 71 3.97e1 SMART
EFh 80 108 4.32e1 SMART
EFh 121 149 1.57e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165324
AA Change: D229N

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000127575
Gene: ENSMUSG00000062007
AA Change: D229N

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
SH2 32 115 1.75e-23 SMART
low complexity region 320 329 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211946
Meta Mutation Damage Score 0.148 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] T-cell activation requires 2 signals: recognition of antigen by the T-cell receptor (see TCR; MIM 186880) and a costimulatory signal provided primarily by CD28 (MIM 186760) in naive T cells. HSH2 is a target of both of these signaling pathways (Greene et al., 2003 [PubMed 12960172]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit enhanced IL-2 production, increased T cell proliferation in response to TCR/CD28 stimulation, splenomegaly, and an increased frequency of activated T cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 6 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 ACAGCAGCAGCAGCAGCAGCAGCAGC ACAGCAGCAGCAGCAGCAGCAGC 6: 86,959,142 probably benign Het
Naip1 C A 13: 100,425,522 R1045L probably benign Het
Nckipsd C T 9: 108,817,545 R649C probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Tpcn2 T C 7: 145,257,235 Y575C probably damaging Het
Unc80 C T 1: 66,521,581 H823Y possibly damaging Het
Other mutations in Hsh2d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01115:Hsh2d APN 8 72200619 missense probably damaging 0.98
IGL01134:Hsh2d APN 8 72193531 missense probably damaging 0.96
IGL01778:Hsh2d APN 8 72193507 missense probably damaging 1.00
IGL03324:Hsh2d APN 8 72193512 missense probably damaging 1.00
R0002:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0064:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0309:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0312:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0369:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0449:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0450:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0481:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0483:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0554:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0704:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0843:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0947:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0948:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0966:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0967:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1051:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1055:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1076:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1105:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1108:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1144:Hsh2d UTSW 8 72193592 splice site probably benign
R1150:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1186:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1345:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1371:Hsh2d UTSW 8 72196894 splice site probably benign
R1400:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1419:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1430:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1514:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1551:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1691:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1857:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1859:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1914:Hsh2d UTSW 8 72193521 missense probably damaging 1.00
R1915:Hsh2d UTSW 8 72193521 missense probably damaging 1.00
R1982:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R2050:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R2081:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R2105:Hsh2d UTSW 8 72200646 missense probably benign
R4077:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R4078:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R4823:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R4824:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R4903:Hsh2d UTSW 8 72193528 missense probably benign
R4966:Hsh2d UTSW 8 72193528 missense probably benign
R6550:Hsh2d UTSW 8 72198453 missense probably benign
R7418:Hsh2d UTSW 8 72196794 critical splice acceptor site probably null
Y4336:Hsh2d UTSW 8 72200460 missense probably benign 0.01
Y4337:Hsh2d UTSW 8 72200460 missense probably benign 0.01
Y4338:Hsh2d UTSW 8 72200460 missense probably benign 0.01
Predicted Primers
Posted On2014-09-11