Incidental Mutation 'R2386:Btnl9'
ID247702
Institutional Source Beutler Lab
Gene Symbol Btnl9
Ensembl Gene ENSMUSG00000040283
Gene Namebutyrophilin-like 9
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R2386 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location49165585-49187159 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 49178775 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 226 (S226P)
Ref Sequence ENSEMBL: ENSMUSP00000066598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046522] [ENSMUST00000066531] [ENSMUST00000153999]
Predicted Effect probably damaging
Transcript: ENSMUST00000046522
AA Change: S226P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000046229
Gene: ENSMUSG00000040283
AA Change: S226P

DomainStartEndE-ValueType
IG 44 151 1.24e-8 SMART
Pfam:Ig_2 155 243 9.2e-3 PFAM
Pfam:C2-set_2 156 238 1.7e-9 PFAM
transmembrane domain 259 281 N/A INTRINSIC
PRY 324 377 8.68e-14 SMART
SPRY 378 503 1.3e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000066531
AA Change: S226P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000066598
Gene: ENSMUSG00000040283
AA Change: S226P

DomainStartEndE-ValueType
IG 44 151 1.24e-8 SMART
Pfam:Ig_3 155 231 1e-4 PFAM
Pfam:C2-set_2 156 238 2.2e-6 PFAM
transmembrane domain 360 382 N/A INTRINSIC
PRY 419 462 3.61e-2 SMART
SPRY 463 588 1.3e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128462
Predicted Effect probably benign
Transcript: ENSMUST00000153999
SMART Domains Protein: ENSMUSP00000120530
Gene: ENSMUSG00000040283

DomainStartEndE-ValueType
IG 44 151 1.24e-8 SMART
transmembrane domain 165 187 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 92.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020L24Rik A G 11: 83,437,749 D2G probably damaging Het
Canx A T 11: 50,297,106 D558E probably benign Het
Cd248 G T 19: 5,069,193 M356I possibly damaging Het
Col1a1 A T 11: 94,950,391 D1200V unknown Het
Dgat2 A C 7: 99,157,093 V299G possibly damaging Het
Ercc6 G A 14: 32,541,359 probably null Het
Fgfr4 T C 13: 55,167,901 V747A probably benign Het
Ftcd A C 10: 76,581,377 D240A probably damaging Het
Hs3st3b1 C A 11: 63,889,213 E363* probably null Het
Ikbke A G 1: 131,259,266 L563P probably damaging Het
Lbhd2 A T 12: 111,410,307 T63S possibly damaging Het
Mterf1a A T 5: 3,891,225 D214E probably benign Het
Olfr473 A G 7: 107,934,273 Y251C probably damaging Het
Pclo A G 5: 14,765,247 E4511G unknown Het
Pigs A G 11: 78,332,986 Y108C probably damaging Het
Pkhd1l1 A G 15: 44,528,178 T1547A probably benign Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Rad54b T A 4: 11,597,874 M253K probably benign Het
Rrp12 T C 19: 41,871,284 D1080G probably benign Het
Sox6 A G 7: 115,597,505 Y298H probably damaging Het
Tdrd9 A T 12: 112,015,900 D475V probably damaging Het
Tmem131 G A 1: 36,829,635 H370Y probably benign Het
Other mutations in Btnl9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01155:Btnl9 APN 11 49175691 missense probably damaging 1.00
IGL01923:Btnl9 APN 11 49180582 missense probably benign 0.00
IGL02129:Btnl9 APN 11 49169273 missense probably damaging 1.00
IGL02248:Btnl9 APN 11 49180798 missense probably benign 0.27
IGL02795:Btnl9 APN 11 49174867 splice site probably benign
IGL02889:Btnl9 APN 11 49178777 missense probably damaging 1.00
IGL02796:Btnl9 UTSW 11 49169181 missense probably damaging 0.99
R0084:Btnl9 UTSW 11 49178779 missense possibly damaging 0.91
R0362:Btnl9 UTSW 11 49169616 missense possibly damaging 0.73
R0417:Btnl9 UTSW 11 49175595 missense probably damaging 1.00
R1199:Btnl9 UTSW 11 49180747 missense probably damaging 1.00
R1260:Btnl9 UTSW 11 49169544 missense probably damaging 0.98
R1802:Btnl9 UTSW 11 49175790 missense probably benign 0.06
R2000:Btnl9 UTSW 11 49169121 missense probably benign 0.04
R2068:Btnl9 UTSW 11 49169563 missense probably damaging 0.98
R2130:Btnl9 UTSW 11 49180696 missense probably damaging 0.99
R2142:Btnl9 UTSW 11 49170626 splice site probably null
R2229:Btnl9 UTSW 11 49169118 missense probably damaging 1.00
R2255:Btnl9 UTSW 11 49169316 nonsense probably null
R3177:Btnl9 UTSW 11 49169676 missense probably damaging 1.00
R3277:Btnl9 UTSW 11 49169676 missense probably damaging 1.00
R3835:Btnl9 UTSW 11 49180685 missense probably damaging 1.00
R5287:Btnl9 UTSW 11 49169607 missense probably benign 0.20
R5352:Btnl9 UTSW 11 49178840 missense probably benign 0.01
R5433:Btnl9 UTSW 11 49176003 intron probably benign
R5490:Btnl9 UTSW 11 49169568 missense probably damaging 1.00
R5576:Btnl9 UTSW 11 49178885 missense probably benign 0.00
R6008:Btnl9 UTSW 11 49182965 critical splice donor site probably null
R6770:Btnl9 UTSW 11 49175565 splice site probably null
R7126:Btnl9 UTSW 11 49169255 missense probably damaging 1.00
R7276:Btnl9 UTSW 11 49175790 missense probably benign 0.06
R7787:Btnl9 UTSW 11 49176039 missense unknown
R7923:Btnl9 UTSW 11 49180738 missense probably damaging 0.97
R8050:Btnl9 UTSW 11 49175615 missense probably benign 0.25
R8558:Btnl9 UTSW 11 49180792 missense probably benign 0.00
R8788:Btnl9 UTSW 11 49175787 missense probably benign 0.03
X0026:Btnl9 UTSW 11 49169241 missense probably damaging 1.00
Z1192:Btnl9 UTSW 11 49175978 missense unknown
Predicted Primers PCR Primer
(F):5'- TCTTCCGGGGTCTCATACAAG -3'
(R):5'- GGCTTCAGTGGAGAAGGTATTC -3'

Sequencing Primer
(F):5'- CTTCCGGGGTCTCATACAAGAGATAG -3'
(R):5'- AAGGTATTCAGCTGCAGTGC -3'
Posted On2014-11-11