Incidental Mutation 'R5433:Btnl9'
ID428167
Institutional Source Beutler Lab
Gene Symbol Btnl9
Ensembl Gene ENSMUSG00000040283
Gene Namebutyrophilin-like 9
Synonyms
MMRRC Submission 042998-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R5433 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location49165585-49187159 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 49176003 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120530 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046522] [ENSMUST00000066531] [ENSMUST00000153999]
Predicted Effect probably benign
Transcript: ENSMUST00000046522
SMART Domains Protein: ENSMUSP00000046229
Gene: ENSMUSG00000040283

DomainStartEndE-ValueType
IG 44 151 1.24e-8 SMART
Pfam:Ig_2 155 243 9.2e-3 PFAM
Pfam:C2-set_2 156 238 1.7e-9 PFAM
transmembrane domain 259 281 N/A INTRINSIC
PRY 324 377 8.68e-14 SMART
SPRY 378 503 1.3e-18 SMART
Predicted Effect unknown
Transcript: ENSMUST00000066531
AA Change: T264S
SMART Domains Protein: ENSMUSP00000066598
Gene: ENSMUSG00000040283
AA Change: T264S

DomainStartEndE-ValueType
IG 44 151 1.24e-8 SMART
Pfam:Ig_3 155 231 1e-4 PFAM
Pfam:C2-set_2 156 238 2.2e-6 PFAM
transmembrane domain 360 382 N/A INTRINSIC
PRY 419 462 3.61e-2 SMART
SPRY 463 588 1.3e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153999
SMART Domains Protein: ENSMUSP00000120530
Gene: ENSMUSG00000040283

DomainStartEndE-ValueType
IG 44 151 1.24e-8 SMART
transmembrane domain 165 187 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019D03Rik T C 1: 52,925,498 S24G probably damaging Het
1810064F22Rik A G 9: 22,207,743 noncoding transcript Het
Aacs A T 5: 125,515,014 M589L probably benign Het
Adamts8 A C 9: 30,961,716 H739P probably benign Het
Atp8b2 T C 3: 89,952,909 probably benign Het
BC030500 A G 8: 58,913,009 probably benign Het
Cd74 G T 18: 60,807,921 A31S probably benign Het
Ceacam3 G A 7: 17,159,883 A440T possibly damaging Het
Ces1d G A 8: 93,186,036 T258I probably benign Het
Col10a1 A G 10: 34,390,739 probably benign Het
Coro1b C T 19: 4,153,450 A430V probably benign Het
Cyp2c65 A T 19: 39,093,484 I485L probably benign Het
Dio1 A T 4: 107,306,780 probably benign Het
Dmxl1 G A 18: 49,867,899 probably null Het
Elp6 A G 9: 110,315,783 Y136C probably damaging Het
Gm1966 T A 7: 106,600,107 noncoding transcript Het
Gon4l A T 3: 88,896,225 Q1382L possibly damaging Het
Guca1a T C 17: 47,400,370 E17G probably damaging Het
Gucy2d G A 7: 98,449,775 G267E probably damaging Het
Hspg2 T A 4: 137,528,794 probably null Het
Il1a G T 2: 129,307,901 D26E possibly damaging Het
Iltifb T A 10: 118,294,884 I36F probably damaging Het
Kcna1 A T 6: 126,643,112 F82I probably damaging Het
Klhl18 G C 9: 110,436,127 N335K possibly damaging Het
Lamtor5 T G 3: 107,282,007 C120G probably benign Het
Lars A G 18: 42,251,298 C72R possibly damaging Het
Lrrfip1 T G 1: 91,087,126 probably null Het
Mapkapk3 T C 9: 107,256,292 D349G probably damaging Het
Mknk2 A T 10: 80,667,225 I421N probably benign Het
Myh6 A G 14: 54,953,924 I820T probably benign Het
Notch2 T G 3: 98,126,134 V1182G probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr30 C T 11: 58,455,854 V32M probably damaging Het
Olfr366 T G 2: 37,219,672 F61C probably damaging Het
Ppfia4 A T 1: 134,317,894 S641T probably damaging Het
Prok1 T A 3: 107,239,633 H6L probably benign Het
Ptprm A T 17: 66,693,473 V1172E probably damaging Het
Rasal3 C T 17: 32,393,601 R762Q probably benign Het
Rgs20 G T 1: 5,070,110 A23E possibly damaging Het
Rprd1a T C 18: 24,507,231 T163A probably benign Het
Rrm1 A T 7: 102,465,767 N37I probably damaging Het
Shc4 T A 2: 125,639,430 E520V probably damaging Het
Slc14a2 G T 18: 78,208,928 P56Q probably damaging Het
Slc22a3 C T 17: 12,458,490 G264S probably damaging Het
Svil A G 18: 5,059,294 E770G probably damaging Het
Svop A G 5: 114,060,125 V129A probably damaging Het
Szt2 A T 4: 118,375,466 probably benign Het
Tcof1 T C 18: 60,818,033 probably benign Het
Tctex1d1 A G 4: 103,002,503 E84G possibly damaging Het
Tmem30a T A 9: 79,780,648 I80F probably damaging Het
Vmn2r16 G T 5: 109,363,842 L638F probably damaging Het
Xkr7 T A 2: 153,054,324 I366N probably damaging Het
Zer1 A G 2: 30,100,986 probably benign Het
Other mutations in Btnl9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01155:Btnl9 APN 11 49175691 missense probably damaging 1.00
IGL01923:Btnl9 APN 11 49180582 missense probably benign 0.00
IGL02129:Btnl9 APN 11 49169273 missense probably damaging 1.00
IGL02248:Btnl9 APN 11 49180798 missense probably benign 0.27
IGL02795:Btnl9 APN 11 49174867 splice site probably benign
IGL02889:Btnl9 APN 11 49178777 missense probably damaging 1.00
IGL02796:Btnl9 UTSW 11 49169181 missense probably damaging 0.99
R0084:Btnl9 UTSW 11 49178779 missense possibly damaging 0.91
R0362:Btnl9 UTSW 11 49169616 missense possibly damaging 0.73
R0417:Btnl9 UTSW 11 49175595 missense probably damaging 1.00
R1199:Btnl9 UTSW 11 49180747 missense probably damaging 1.00
R1260:Btnl9 UTSW 11 49169544 missense probably damaging 0.98
R1802:Btnl9 UTSW 11 49175790 missense probably benign 0.06
R2000:Btnl9 UTSW 11 49169121 missense probably benign 0.04
R2068:Btnl9 UTSW 11 49169563 missense probably damaging 0.98
R2130:Btnl9 UTSW 11 49180696 missense probably damaging 0.99
R2142:Btnl9 UTSW 11 49170626 splice site probably null
R2229:Btnl9 UTSW 11 49169118 missense probably damaging 1.00
R2255:Btnl9 UTSW 11 49169316 nonsense probably null
R2386:Btnl9 UTSW 11 49178775 missense probably damaging 1.00
R3177:Btnl9 UTSW 11 49169676 missense probably damaging 1.00
R3277:Btnl9 UTSW 11 49169676 missense probably damaging 1.00
R3835:Btnl9 UTSW 11 49180685 missense probably damaging 1.00
R5287:Btnl9 UTSW 11 49169607 missense probably benign 0.20
R5352:Btnl9 UTSW 11 49178840 missense probably benign 0.01
R5490:Btnl9 UTSW 11 49169568 missense probably damaging 1.00
R5576:Btnl9 UTSW 11 49178885 missense probably benign 0.00
R6008:Btnl9 UTSW 11 49182965 critical splice donor site probably null
R6770:Btnl9 UTSW 11 49175565 splice site probably null
R7126:Btnl9 UTSW 11 49169255 missense probably damaging 1.00
R7276:Btnl9 UTSW 11 49175790 missense probably benign 0.06
R7787:Btnl9 UTSW 11 49176039 missense unknown
R7923:Btnl9 UTSW 11 49180738 missense probably damaging 0.97
R8050:Btnl9 UTSW 11 49175615 missense probably benign 0.25
R8558:Btnl9 UTSW 11 49180792 missense probably benign 0.00
R8788:Btnl9 UTSW 11 49175787 missense probably benign 0.03
X0026:Btnl9 UTSW 11 49169241 missense probably damaging 1.00
Z1192:Btnl9 UTSW 11 49175978 missense unknown
Predicted Primers PCR Primer
(F):5'- TCTTCAGTGGGAGCCTCTCTAG -3'
(R):5'- GCTGTTATTACCCCAGAGCC -3'

Sequencing Primer
(F):5'- GAGCCTCTCTAGCCAGGTATGAAC -3'
(R):5'- ATTTCACCTGCAGGCCACTAG -3'
Posted On2016-09-01