Incidental Mutation 'R2936:Jcad'
ID255033
Institutional Source Beutler Lab
Gene Symbol Jcad
Ensembl Gene ENSMUSG00000033960
Gene Namejunctional cadherin 5 associated
Synonyms9430020K01Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2936 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location4634929-4682868 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 4675153 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 972 (Y972N)
Ref Sequence ENSEMBL: ENSMUSP00000038613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037029]
Predicted Effect probably benign
Transcript: ENSMUST00000037029
AA Change: Y972N

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000038613
Gene: ENSMUSG00000033960
AA Change: Y972N

DomainStartEndE-ValueType
Pfam:JCAD 1 1309 N/A PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik A T 18: 70,468,448 M121K probably damaging Het
Cacybp A T 1: 160,208,377 probably null Het
Cd6 T C 19: 10,796,322 probably null Het
Cep162 T C 9: 87,227,414 T379A probably benign Het
Gaa T C 11: 119,283,724 V799A probably benign Het
Gm16503 A G 4: 147,541,247 D66G unknown Het
Hspa9 T C 18: 34,948,014 T205A probably damaging Het
Ihh A G 1: 74,946,546 I260T probably damaging Het
Magi2 A AG 5: 20,602,461 probably null Het
Mmp12 A G 9: 7,357,819 Q341R probably benign Het
Nup155 T C 15: 8,143,049 S840P possibly damaging Het
Olfr724 A T 14: 49,960,154 V306E probably benign Het
Papd7 G A 13: 69,502,327 T621I possibly damaging Het
Pde4b C T 4: 102,601,545 A466V probably damaging Het
Pde5a A G 3: 122,794,319 E378G probably damaging Het
Rad54l T C 4: 116,122,879 probably benign Het
Stbd1 C T 5: 92,603,260 P51L possibly damaging Het
Tnfaip3 A G 10: 19,011,609 F56S probably damaging Het
Tnr A C 1: 159,888,362 Y898S probably damaging Het
Trav6n-6 A G 14: 53,132,884 T31A probably benign Het
Other mutations in Jcad
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00650:Jcad APN 18 4675692 missense probably benign 0.14
IGL00672:Jcad APN 18 4674835 missense possibly damaging 0.77
IGL00782:Jcad APN 18 4675073 missense probably benign 0.00
IGL00825:Jcad APN 18 4673516 missense probably damaging 1.00
IGL01522:Jcad APN 18 4673312 missense probably damaging 0.97
IGL01796:Jcad APN 18 4672855 nonsense probably null
IGL01973:Jcad APN 18 4675514 missense probably benign 0.21
IGL02083:Jcad APN 18 4680266 utr 3 prime probably benign
IGL02625:Jcad APN 18 4674422 missense probably benign 0.03
IGL03002:Jcad APN 18 4675153 missense probably benign 0.00
IGL03325:Jcad APN 18 4673902 missense probably benign
R0304:Jcad UTSW 18 4673325 missense possibly damaging 0.75
R0487:Jcad UTSW 18 4673243 missense probably damaging 1.00
R0519:Jcad UTSW 18 4649122 start gained probably benign
R0664:Jcad UTSW 18 4676063 missense probably damaging 0.97
R1649:Jcad UTSW 18 4673309 missense probably damaging 1.00
R1710:Jcad UTSW 18 4674511 missense probably damaging 1.00
R1734:Jcad UTSW 18 4674526 missense probably damaging 1.00
R1823:Jcad UTSW 18 4675780 missense probably damaging 1.00
R1824:Jcad UTSW 18 4649293 missense probably benign
R1850:Jcad UTSW 18 4675730 missense possibly damaging 0.95
R1872:Jcad UTSW 18 4673048 missense probably benign
R1878:Jcad UTSW 18 4673857 missense possibly damaging 0.60
R1918:Jcad UTSW 18 4674292 missense probably damaging 1.00
R1967:Jcad UTSW 18 4675162 missense probably benign 0.07
R2420:Jcad UTSW 18 4675952 missense probably damaging 1.00
R2504:Jcad UTSW 18 4674026 missense probably damaging 0.99
R4420:Jcad UTSW 18 4676032 missense probably benign 0.00
R4668:Jcad UTSW 18 4680221 splice site probably null
R4670:Jcad UTSW 18 4674175 missense probably benign 0.03
R4671:Jcad UTSW 18 4674175 missense probably benign 0.03
R4707:Jcad UTSW 18 4649338 nonsense probably null
R4720:Jcad UTSW 18 4674055 missense probably benign 0.03
R4815:Jcad UTSW 18 4675223 missense possibly damaging 0.94
R4906:Jcad UTSW 18 4673762 missense probably damaging 1.00
R5214:Jcad UTSW 18 4674134 missense probably damaging 1.00
R5439:Jcad UTSW 18 4675790 missense probably damaging 1.00
R5563:Jcad UTSW 18 4673944 missense possibly damaging 0.93
R5721:Jcad UTSW 18 4676044 missense possibly damaging 0.48
R5825:Jcad UTSW 18 4674896 missense probably benign 0.00
R5952:Jcad UTSW 18 4674554 missense probably damaging 1.00
R6661:Jcad UTSW 18 4675256 missense probably damaging 1.00
R6928:Jcad UTSW 18 4673372 missense probably benign 0.00
R7426:Jcad UTSW 18 4675529 missense probably benign 0.11
R7808:Jcad UTSW 18 4673113 missense probably damaging 1.00
T0722:Jcad UTSW 18 4675531 missense probably benign 0.25
X0017:Jcad UTSW 18 4676044 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAGTGTCCATCCACAGTCCC -3'
(R):5'- TTCTTGTCCCAGTGTGAGC -3'

Sequencing Primer
(F):5'- ATCCACAGTCCCTGGGC -3'
(R):5'- TGTCCCAGTGTGAGCTCTAAAGAC -3'
Posted On2014-12-29