Incidental Mutation 'R3409:Rpn2'
ID258408
Institutional Source Beutler Lab
Gene Symbol Rpn2
Ensembl Gene ENSMUSG00000027642
Gene Nameribophorin II
SynonymsRpn-2, 1300012C06Rik
MMRRC Submission 040627-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3409 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location157279017-157326319 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 157290652 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 108 (A108E)
Ref Sequence ENSEMBL: ENSMUSP00000029171 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029171] [ENSMUST00000116380]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029171
AA Change: A108E

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000029171
Gene: ENSMUSG00000027642
AA Change: A108E

DomainStartEndE-ValueType
Pfam:Ribophorin_II 2 71 1.5e-15 PFAM
Pfam:Ribophorin_II 68 596 3.5e-247 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000116380
AA Change: A140E

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000112081
Gene: ENSMUSG00000027642
AA Change: A140E

DomainStartEndE-ValueType
Pfam:Ribophorin_II 9 627 1.8e-223 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125311
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126248
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127252
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142463
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150349
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156007
Meta Mutation Damage Score 0.1706 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type I integral membrane protein found only in the rough endoplasmic reticulum. The encoded protein is part of an N-oligosaccharyl transferase complex that links high mannose oligosaccharides to asparagine residues found in the Asn-X-Ser/Thr consensus motif of nascent polypeptide chains. This protein is similar in sequence to the yeast oligosaccharyl transferase subunit SWP1. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra3 A G 5: 50,001,930 V326A probably damaging Het
AI429214 C T 8: 36,993,917 S73L probably benign Het
Atp13a4 G T 16: 29,413,749 T923K probably damaging Het
Ccdc150 A G 1: 54,356,773 D805G probably benign Het
Ccdc185 T G 1: 182,748,748 Q125H possibly damaging Het
Ccdc88a T A 11: 29,486,006 C10S probably damaging Het
Cpsf1 G T 15: 76,601,781 Y396* probably null Het
Dnpep A G 1: 75,316,626 V33A probably damaging Het
Fbn1 G A 2: 125,412,665 A226V possibly damaging Het
Frmd4a A T 2: 4,153,028 probably benign Het
Gipr A G 7: 19,159,794 V318A possibly damaging Het
Gsdmc4 A G 15: 63,892,046 S401P probably benign Het
H2-M10.6 T A 17: 36,814,001 V270E probably damaging Het
Klhl7 G T 5: 24,138,321 V212L probably damaging Het
Krt10 C A 11: 99,387,261 R322L probably damaging Het
Lrrn4 A G 2: 132,879,861 L12P unknown Het
Mast2 C G 4: 116,310,910 E881Q possibly damaging Het
Nod1 G T 6: 54,944,917 R139S probably benign Het
Notch3 C T 17: 32,150,702 V772M possibly damaging Het
Nrxn1 G A 17: 90,208,367 T19M probably damaging Het
Nudcd1 T C 15: 44,420,811 M60V probably benign Het
Olfr1151 T A 2: 87,857,661 L162* probably null Het
Olfr1220 T C 2: 89,097,324 N201S possibly damaging Het
Olfr1231 A G 2: 89,303,373 F73S probably benign Het
Olfr1453 G C 19: 13,028,047 A94G probably benign Het
Olfr1510 T A 14: 52,410,361 R170S possibly damaging Het
Olfr25 T A 9: 38,330,344 S252R possibly damaging Het
Pcdhb6 A G 18: 37,335,892 E622G probably damaging Het
Pitrm1 G A 13: 6,578,481 A937T possibly damaging Het
Plxnb1 G A 9: 109,106,613 probably null Het
Ripk3 T G 14: 55,788,241 N54T probably damaging Het
Scaf11 A G 15: 96,414,864 V1432A probably damaging Het
Sec14l5 C T 16: 5,165,654 probably null Het
Serpina3n A G 12: 104,411,277 E263G possibly damaging Het
Six4 A G 12: 73,112,883 F101S probably damaging Het
Slc12a1 A G 2: 125,154,151 T75A probably benign Het
Slc26a9 T C 1: 131,763,944 S642P probably benign Het
Smu1 T C 4: 40,752,008 T183A probably benign Het
Sptb T G 12: 76,610,815 K1311Q possibly damaging Het
Tal2 A G 4: 53,785,843 N8S probably damaging Het
Tenm4 A G 7: 96,895,160 T2128A probably damaging Het
Tmem67 A T 4: 12,073,952 M288K probably benign Het
Ubr1 A C 2: 120,963,448 I85S probably benign Het
Vmn2r90 G T 17: 17,733,376 V601L probably benign Het
Zfhx4 C T 3: 5,403,358 P2859S probably benign Het
Other mutations in Rpn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Rpn2 APN 2 157314913 missense probably damaging 1.00
IGL01894:Rpn2 APN 2 157294173 missense probably benign 0.45
IGL02104:Rpn2 APN 2 157321827 missense probably damaging 1.00
IGL02368:Rpn2 APN 2 157302408 missense probably benign
IGL02819:Rpn2 APN 2 157316210 critical splice donor site probably null
R0932:Rpn2 UTSW 2 157283771 missense possibly damaging 0.66
R1666:Rpn2 UTSW 2 157294155 missense possibly damaging 0.93
R1668:Rpn2 UTSW 2 157294155 missense possibly damaging 0.93
R1713:Rpn2 UTSW 2 157314968 missense probably damaging 0.99
R2276:Rpn2 UTSW 2 157310288 missense possibly damaging 0.64
R2279:Rpn2 UTSW 2 157310288 missense possibly damaging 0.64
R3411:Rpn2 UTSW 2 157290652 missense possibly damaging 0.91
R3777:Rpn2 UTSW 2 157299557 missense probably damaging 0.99
R4004:Rpn2 UTSW 2 157318008 missense probably damaging 1.00
R4575:Rpn2 UTSW 2 157295324 missense probably damaging 1.00
R4613:Rpn2 UTSW 2 157302425 missense possibly damaging 0.87
R4856:Rpn2 UTSW 2 157318044 critical splice donor site probably null
R4886:Rpn2 UTSW 2 157318044 critical splice donor site probably null
R5491:Rpn2 UTSW 2 157297383 missense probably damaging 0.99
R5526:Rpn2 UTSW 2 157323267 missense probably damaging 1.00
R5633:Rpn2 UTSW 2 157283596 missense possibly damaging 0.81
R5718:Rpn2 UTSW 2 157321827 missense probably damaging 1.00
R5772:Rpn2 UTSW 2 157295345 missense probably damaging 1.00
R6101:Rpn2 UTSW 2 157310188 splice site probably null
R6618:Rpn2 UTSW 2 157321861 missense probably benign
R6698:Rpn2 UTSW 2 157297410 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TAGCCTTGGCAGCTGTGTTC -3'
(R):5'- TGTCTGCACATCTAGCAGAG -3'

Sequencing Primer
(F):5'- GGTCGGTATGCCTTTCACAAACTG -3'
(R):5'- ATCTAGCAGAGCACCTGGC -3'
Posted On2015-01-23