Incidental Mutation 'R0330:Gtf2i'
ID25987
Institutional Source Beutler Lab
Gene Symbol Gtf2i
Ensembl Gene ENSMUSG00000060261
Gene Namegeneral transcription factor II I
SynonymsBAP-135, 6030441I21Rik, TFII-I
MMRRC Submission 038539-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0330 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location134237834-134314760 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 134251886 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 518 (E518G)
Ref Sequence ENSEMBL: ENSMUSP00000133969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059042] [ENSMUST00000082057] [ENSMUST00000111261] [ENSMUST00000172715] [ENSMUST00000173341] [ENSMUST00000173888] [ENSMUST00000174155] [ENSMUST00000174354] [ENSMUST00000174513] [ENSMUST00000174772]
Predicted Effect probably benign
Transcript: ENSMUST00000059042
AA Change: E577G

PolyPhen 2 Score 0.434 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000049625
Gene: ENSMUSG00000060261
AA Change: E577G

DomainStartEndE-ValueType
low complexity region 82 94 N/A INTRINSIC
Pfam:GTF2I 112 187 1.4e-34 PFAM
low complexity region 328 338 N/A INTRINSIC
Pfam:GTF2I 361 436 3.4e-33 PFAM
Pfam:GTF2I 466 541 5e-34 PFAM
Pfam:GTF2I 571 646 3.3e-33 PFAM
Pfam:GTF2I 733 808 3.9e-33 PFAM
Pfam:GTF2I 868 943 9.4e-30 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000082057
AA Change: E556G

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000080714
Gene: ENSMUSG00000060261
AA Change: E556G

DomainStartEndE-ValueType
low complexity region 82 94 N/A INTRINSIC
Pfam:GTF2I 112 187 1.3e-34 PFAM
low complexity region 307 317 N/A INTRINSIC
Pfam:GTF2I 340 415 3.3e-33 PFAM
Pfam:GTF2I 445 520 4.9e-34 PFAM
Pfam:GTF2I 550 625 3.2e-33 PFAM
Pfam:GTF2I 712 787 3.8e-33 PFAM
Pfam:GTF2I 847 922 9.1e-30 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000111261
AA Change: E558G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000106892
Gene: ENSMUSG00000060261
AA Change: E558G

DomainStartEndE-ValueType
low complexity region 82 94 N/A INTRINSIC
Pfam:GTF2I 112 187 1.3e-34 PFAM
low complexity region 309 319 N/A INTRINSIC
Pfam:GTF2I 342 417 3.3e-33 PFAM
Pfam:GTF2I 447 522 4.9e-34 PFAM
Pfam:GTF2I 552 627 3.2e-33 PFAM
Pfam:GTF2I 714 789 3.8e-33 PFAM
Pfam:GTF2I 849 924 9.1e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172715
AA Change: E492G

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000134035
Gene: ENSMUSG00000060261
AA Change: E492G

DomainStartEndE-ValueType
low complexity region 82 94 N/A INTRINSIC
Pfam:GTF2I 112 187 9.7e-35 PFAM
low complexity region 243 253 N/A INTRINSIC
Pfam:GTF2I 276 351 2.4e-33 PFAM
Pfam:GTF2I 381 456 3.6e-34 PFAM
Pfam:GTF2I 486 561 2.4e-33 PFAM
Pfam:GTF2I 648 723 2.8e-33 PFAM
Pfam:GTF2I 783 858 6.7e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172904
Predicted Effect possibly damaging
Transcript: ENSMUST00000173341
AA Change: E537G

PolyPhen 2 Score 0.688 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000133444
Gene: ENSMUSG00000060261
AA Change: E537G

DomainStartEndE-ValueType
low complexity region 82 94 N/A INTRINSIC
Pfam:GTF2I 112 187 1e-34 PFAM
low complexity region 288 298 N/A INTRINSIC
Pfam:GTF2I 321 396 2.6e-33 PFAM
Pfam:GTF2I 426 501 3.8e-34 PFAM
Pfam:GTF2I 531 606 2.5e-33 PFAM
Pfam:GTF2I 693 768 3e-33 PFAM
Pfam:GTF2I 832 907 7.1e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000173888
AA Change: E518G

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000133969
Gene: ENSMUSG00000060261
AA Change: E518G

DomainStartEndE-ValueType
low complexity region 82 94 N/A INTRINSIC
Pfam:GTF2I 112 187 1.3e-34 PFAM
low complexity region 245 258 N/A INTRINSIC
low complexity region 269 279 N/A INTRINSIC
Pfam:GTF2I 302 377 3.2e-33 PFAM
Pfam:GTF2I 407 482 4.6e-34 PFAM
Pfam:GTF2I 512 587 3.1e-33 PFAM
Pfam:GTF2I 674 749 3.6e-33 PFAM
Pfam:GTF2I 809 884 8.7e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174133
SMART Domains Protein: ENSMUSP00000134111
Gene: ENSMUSG00000060261

DomainStartEndE-ValueType
low complexity region 66 78 N/A INTRINSIC
Pfam:GTF2I 96 170 2.7e-32 PFAM
low complexity region 209 225 N/A INTRINSIC
low complexity region 246 256 N/A INTRINSIC
Pfam:GTF2I 279 353 5.1e-31 PFAM
Pfam:GTF2I 384 437 2.7e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174155
AA Change: E577G

PolyPhen 2 Score 0.434 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000133566
Gene: ENSMUSG00000060261
AA Change: E577G

DomainStartEndE-ValueType
low complexity region 82 94 N/A INTRINSIC
Pfam:GTF2I 112 186 1.6e-34 PFAM
low complexity region 328 338 N/A INTRINSIC
Pfam:GTF2I 361 435 3e-33 PFAM
Pfam:GTF2I 466 540 9.1e-34 PFAM
Pfam:GTF2I 571 645 1.8e-32 PFAM
Pfam:GTF2I 733 807 2.2e-33 PFAM
Pfam:GTF2I 868 942 6e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174182
Predicted Effect possibly damaging
Transcript: ENSMUST00000174354
AA Change: E558G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000134440
Gene: ENSMUSG00000060261
AA Change: E558G

DomainStartEndE-ValueType
low complexity region 82 94 N/A INTRINSIC
Pfam:GTF2I 112 187 1.3e-34 PFAM
low complexity region 309 319 N/A INTRINSIC
Pfam:GTF2I 342 417 3.3e-33 PFAM
Pfam:GTF2I 447 522 4.9e-34 PFAM
Pfam:GTF2I 552 627 3.2e-33 PFAM
Pfam:GTF2I 714 789 3.8e-33 PFAM
Pfam:GTF2I 849 924 9.1e-30 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000174513
AA Change: E537G

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000133489
Gene: ENSMUSG00000060261
AA Change: E537G

DomainStartEndE-ValueType
low complexity region 82 94 N/A INTRINSIC
Pfam:GTF2I 112 187 1.3e-34 PFAM
low complexity region 288 298 N/A INTRINSIC
Pfam:GTF2I 321 396 3.2e-33 PFAM
Pfam:GTF2I 426 501 4.8e-34 PFAM
Pfam:GTF2I 531 606 3.2e-33 PFAM
Pfam:GTF2I 693 768 3.7e-33 PFAM
Pfam:GTF2I 828 903 8.9e-30 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000174772
AA Change: E556G

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000133740
Gene: ENSMUSG00000060261
AA Change: E556G

DomainStartEndE-ValueType
low complexity region 82 94 N/A INTRINSIC
Pfam:GTF2I 112 187 1.3e-34 PFAM
low complexity region 307 317 N/A INTRINSIC
Pfam:GTF2I 340 415 3.3e-33 PFAM
Pfam:GTF2I 445 520 4.9e-34 PFAM
Pfam:GTF2I 550 625 3.2e-33 PFAM
Pfam:GTF2I 712 787 3.8e-33 PFAM
Pfam:GTF2I 847 922 9.1e-30 PFAM
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.7%
  • 20x: 88.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphoprotein containing six characteristic repeat motifs. The encoded protein binds to the initiator element (Inr) and E-box element in promoters and functions as a regulator of transcription. This locus, along with several other neighboring genes, is deleted in Williams-Beuren syndrome. There are many closely related genes and pseudogenes for this gene on chromosome 7. This gene also has pseudogenes on chromosomes 9, 13, and 21. Alternatively spliced transcript variants encoding multiple isoforms have been observed. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygotes for null allele is embryonic lethal, and show brain hemorrhage and neural tube defects. Although most heterozygote are normal and fertile, at low frequency, growth retardation and small head are also reported. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A T 17: 56,883,631 I400F probably benign Het
4833423E24Rik T A 2: 85,518,551 R72S probably benign Het
Acaa1b T C 9: 119,153,970 N120S probably damaging Het
Acvr1c T C 2: 58,284,838 T313A probably damaging Het
Adamtsl3 A T 7: 82,521,990 D417V probably damaging Het
Adgrf4 A T 17: 42,667,313 C380S probably damaging Het
AI597479 T G 1: 43,111,117 L129R probably benign Het
AI661453 G A 17: 47,446,646 R76Q probably damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Anxa7 A C 14: 20,469,498 probably null Het
Arhgap12 T A 18: 6,039,382 D455V probably damaging Het
Arhgap22 A G 14: 33,369,417 R650G possibly damaging Het
Arhgef12 A C 9: 43,020,686 H168Q probably damaging Het
Arhgef2 A G 3: 88,642,501 H592R probably damaging Het
BC049715 A G 6: 136,840,037 T92A possibly damaging Het
Bcr C T 10: 75,181,634 T1209I possibly damaging Het
Bmpr1a C T 14: 34,429,777 S185N probably benign Het
Calcoco1 A T 15: 102,715,763 M246K probably benign Het
Capn8 T A 1: 182,630,138 I689N probably benign Het
Ccno T A 13: 112,989,996 L333Q probably damaging Het
Cep57 G A 9: 13,816,985 R148W probably damaging Het
Cftr T A 6: 18,226,097 M318K probably null Het
Chd3 T G 11: 69,356,333 D1003A probably damaging Het
Ckmt2 T A 13: 91,863,203 D96V possibly damaging Het
Cldn13 A G 5: 134,915,322 V3A probably benign Het
Col17a1 T C 19: 47,670,432 T413A probably benign Het
Cpne5 A T 17: 29,211,660 L92H probably damaging Het
Dnaaf2 C A 12: 69,197,744 R181L probably damaging Het
Erbin C A 13: 103,868,865 C114F probably damaging Het
Fanca A T 8: 123,274,172 C1156* probably null Het
Flot2 T A 11: 78,058,958 I322N possibly damaging Het
Fstl5 T C 3: 76,707,753 V707A possibly damaging Het
Gli3 T G 13: 15,723,558 L741R probably damaging Het
Gmip G T 8: 69,810,818 S70I probably benign Het
Gnptab T C 10: 88,440,309 S1153P probably damaging Het
Gramd1a T C 7: 31,138,254 D360G possibly damaging Het
Hrasls5 T A 19: 7,637,298 probably null Het
Hsp90b1 T C 10: 86,694,155 E226G probably damaging Het
Impg2 A G 16: 56,252,264 Y353C probably damaging Het
Kank1 A G 19: 25,424,313 K1095E probably benign Het
Kcnh4 C T 11: 100,757,743 C45Y probably damaging Het
Kif13b A G 14: 64,803,220 T1590A probably benign Het
Lpin3 T C 2: 160,905,305 V827A probably benign Het
Lrp1b A T 2: 40,701,761 C73* probably null Het
Mcm8 A G 2: 132,819,994 K83E possibly damaging Het
Med12l A G 3: 59,227,702 E757G probably damaging Het
Mep1a A G 17: 43,497,898 probably null Het
Mtor T A 4: 148,484,380 V1119E probably benign Het
Mybpc2 C T 7: 44,509,029 A710T possibly damaging Het
Myof A C 19: 37,935,878 I1297S probably damaging Het
Nacad A G 11: 6,600,903 S763P probably benign Het
Nbea A G 3: 55,642,817 V2730A probably benign Het
Nbeal1 A G 1: 60,268,063 Y1684C probably damaging Het
Olfr1015 T A 2: 85,785,803 C97* probably null Het
Olfr123 A T 17: 37,795,989 M182L probably benign Het
Olfr370 A G 8: 83,541,513 Y123C probably damaging Het
Olfr828 A G 9: 18,815,641 Y218H probably damaging Het
Optn A T 2: 5,034,255 N352K possibly damaging Het
Pcif1 G T 2: 164,889,444 R466L probably damaging Het
Phxr2 T C 10: 99,126,117 probably benign Het
Plb1 T A 5: 32,355,357 F1353Y probably damaging Het
Plec A G 15: 76,191,418 probably null Het
Polr1a T A 6: 71,966,416 C1212S possibly damaging Het
Primpol A T 8: 46,610,461 N53K probably damaging Het
Pygo2 T A 3: 89,433,154 N286K possibly damaging Het
Rttn G A 18: 88,986,080 probably null Het
Serpinb3b G T 1: 107,159,703 N25K probably damaging Het
Sidt2 A G 9: 45,954,902 I2T probably benign Het
Slc12a3 A T 8: 94,346,346 N699I possibly damaging Het
Slc25a30 G A 14: 75,762,672 Q285* probably null Het
Slc4a9 A T 18: 36,535,539 H724L probably damaging Het
Ssbp2 T A 13: 91,680,579 probably null Het
Stac3 C A 10: 127,507,747 probably null Het
Stk32a A G 18: 43,313,501 K339E probably benign Het
Stoml2 A G 4: 43,030,238 probably null Het
Syne2 G T 12: 75,966,953 G2974C probably benign Het
Tbc1d16 A G 11: 119,158,729 probably null Het
Tfdp2 T G 9: 96,306,893 F200V probably damaging Het
Tie1 C A 4: 118,484,727 R175L probably benign Het
Trappc12 A G 12: 28,747,260 V91A probably benign Het
Trim46 G T 3: 89,236,513 P536Q probably damaging Het
Tshz3 T A 7: 36,770,033 D482E probably benign Het
Tspan33 T C 6: 29,711,092 probably null Het
Unc80 T C 1: 66,674,087 L2788P possibly damaging Het
Utp20 T A 10: 88,817,979 T260S probably benign Het
Vmn2r118 G T 17: 55,610,717 T265K probably damaging Het
Vmn2r98 A C 17: 19,066,347 H369P probably benign Het
Vps39 A T 2: 120,338,787 Y245N possibly damaging Het
Vps4a A C 8: 107,043,066 I336L probably benign Het
Xylb T C 9: 119,381,587 S379P probably damaging Het
Zbtb37 T C 1: 161,032,496 T80A probably benign Het
Zfhx3 A G 8: 108,948,957 D2213G probably damaging Het
Zfp729a G T 13: 67,620,354 H585Q probably damaging Het
Zfp804b A T 5: 6,771,029 I642N possibly damaging Het
Zfp804b A T 5: 6,771,994 N356K possibly damaging Het
Other mutations in Gtf2i
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Gtf2i APN 5 134242748 missense probably damaging 1.00
IGL01565:Gtf2i APN 5 134255913 missense probably damaging 0.97
IGL01743:Gtf2i APN 5 134286893 missense probably damaging 1.00
IGL01809:Gtf2i APN 5 134249950 missense probably damaging 1.00
IGL02553:Gtf2i APN 5 134245161 missense probably damaging 1.00
IGL02814:Gtf2i APN 5 134286704 missense probably damaging 1.00
IGL02869:Gtf2i APN 5 134279427 splice site probably benign
IGL03018:Gtf2i APN 5 134289335 missense possibly damaging 0.79
IGL03051:Gtf2i APN 5 134242914 nonsense probably null
P0041:Gtf2i UTSW 5 134244888 splice site probably benign
R0515:Gtf2i UTSW 5 134242919 missense probably damaging 1.00
R0529:Gtf2i UTSW 5 134261869 nonsense probably null
R0594:Gtf2i UTSW 5 134242173 splice site probably benign
R0650:Gtf2i UTSW 5 134261837 splice site probably benign
R1055:Gtf2i UTSW 5 134263624 missense probably damaging 1.00
R1079:Gtf2i UTSW 5 134242894 splice site probably benign
R1916:Gtf2i UTSW 5 134246848 missense probably damaging 1.00
R2969:Gtf2i UTSW 5 134251892 missense probably damaging 0.98
R3013:Gtf2i UTSW 5 134295504 splice site probably benign
R4392:Gtf2i UTSW 5 134260629 missense probably damaging 0.96
R4421:Gtf2i UTSW 5 134255037 missense possibly damaging 0.86
R4635:Gtf2i UTSW 5 134245174 missense probably damaging 1.00
R4763:Gtf2i UTSW 5 134255964 missense probably damaging 1.00
R4770:Gtf2i UTSW 5 134243560 missense possibly damaging 0.53
R5063:Gtf2i UTSW 5 134260571 missense probably damaging 1.00
R5195:Gtf2i UTSW 5 134244832 nonsense probably null
R5829:Gtf2i UTSW 5 134263693 missense probably damaging 1.00
R6005:Gtf2i UTSW 5 134255958 nonsense probably null
R6119:Gtf2i UTSW 5 134287057 splice site probably null
R6576:Gtf2i UTSW 5 134263702 missense probably damaging 1.00
R6936:Gtf2i UTSW 5 134242785 missense probably damaging 1.00
R7070:Gtf2i UTSW 5 134282803 missense probably damaging 1.00
R7071:Gtf2i UTSW 5 134263621 missense probably damaging 1.00
R7142:Gtf2i UTSW 5 134244851 missense possibly damaging 0.95
R7366:Gtf2i UTSW 5 134265749 missense probably damaging 1.00
R7694:Gtf2i UTSW 5 134282805 missense probably damaging 1.00
R7879:Gtf2i UTSW 5 134266617 missense possibly damaging 0.77
R7962:Gtf2i UTSW 5 134266617 missense possibly damaging 0.77
R8039:Gtf2i UTSW 5 134255834 missense possibly damaging 0.95
R8041:Gtf2i UTSW 5 134293745 critical splice donor site probably null
X0022:Gtf2i UTSW 5 134263616 missense probably damaging 1.00
Z1176:Gtf2i UTSW 5 134263645 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- GGTGAGACGCACAGTGACTCTAAG -3'
(R):5'- GTTTCAGGTGGTGACAGTCATGTCC -3'

Sequencing Primer
(F):5'- CACTGGGACACTGGAGAACAC -3'
(R):5'- TCCACCATGGATGAGTTCATGG -3'
Posted On2013-04-16