Incidental Mutation 'R3053:Bcl11b'
ID265044
Institutional Source Beutler Lab
Gene Symbol Bcl11b
Ensembl Gene ENSMUSG00000048251
Gene NameB cell leukemia/lymphoma 11B
Synonyms9130430L19Rik, CTIP2, B630002E05Rik, COUP-TF interacting protein 2, Rit1
MMRRC Submission 040562-MU
Accession Numbers

Genbank: NM_001079883; MGI: 1929913

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3053 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location107910403-108003602 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107916001 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 613 (E613G)
Ref Sequence ENSEMBL: ENSMUSP00000105517 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066060] [ENSMUST00000109887] [ENSMUST00000109891]
Predicted Effect probably benign
Transcript: ENSMUST00000066060
AA Change: E685G

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000068258
Gene: ENSMUSG00000048251
AA Change: E685G

DomainStartEndE-ValueType
low complexity region 29 40 N/A INTRINSIC
Blast:ZnF_C2H2 56 81 5e-10 BLAST
low complexity region 95 113 N/A INTRINSIC
ZnF_C2H2 221 244 1.16e-1 SMART
low complexity region 311 330 N/A INTRINSIC
ZnF_C2H2 426 448 6.23e-2 SMART
ZnF_C2H2 454 476 2.75e-3 SMART
low complexity region 519 551 N/A INTRINSIC
low complexity region 566 593 N/A INTRINSIC
low complexity region 617 636 N/A INTRINSIC
low complexity region 639 656 N/A INTRINSIC
low complexity region 659 675 N/A INTRINSIC
low complexity region 743 765 N/A INTRINSIC
ZnF_C2H2 786 808 1.41e0 SMART
ZnF_C2H2 814 836 4.24e-4 SMART
ZnF_C2H2 844 867 3.07e-1 SMART
Predicted Effect unknown
Transcript: ENSMUST00000109887
AA Change: E491G
SMART Domains Protein: ENSMUSP00000105513
Gene: ENSMUSG00000048251
AA Change: E491G

DomainStartEndE-ValueType
ZnF_C2H2 27 50 1.16e-1 SMART
low complexity region 117 136 N/A INTRINSIC
ZnF_C2H2 232 254 6.23e-2 SMART
ZnF_C2H2 260 282 2.75e-3 SMART
low complexity region 325 357 N/A INTRINSIC
low complexity region 372 399 N/A INTRINSIC
low complexity region 423 442 N/A INTRINSIC
low complexity region 445 462 N/A INTRINSIC
low complexity region 465 481 N/A INTRINSIC
low complexity region 549 571 N/A INTRINSIC
ZnF_C2H2 592 614 1.41e0 SMART
ZnF_C2H2 620 642 4.24e-4 SMART
ZnF_C2H2 650 673 3.07e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109891
AA Change: E613G

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000105517
Gene: ENSMUSG00000048251
AA Change: E613G

DomainStartEndE-ValueType
low complexity region 29 40 N/A INTRINSIC
Pfam:zf-C2H2_6 55 83 3.9e-9 PFAM
low complexity region 95 113 N/A INTRINSIC
ZnF_C2H2 149 172 1.16e-1 SMART
low complexity region 239 258 N/A INTRINSIC
ZnF_C2H2 354 376 6.23e-2 SMART
ZnF_C2H2 382 404 2.75e-3 SMART
low complexity region 447 479 N/A INTRINSIC
low complexity region 494 521 N/A INTRINSIC
low complexity region 545 564 N/A INTRINSIC
low complexity region 567 584 N/A INTRINSIC
low complexity region 587 603 N/A INTRINSIC
low complexity region 671 693 N/A INTRINSIC
ZnF_C2H2 714 736 1.41e0 SMART
ZnF_C2H2 742 764 4.24e-4 SMART
ZnF_C2H2 772 795 3.07e-1 SMART
Meta Mutation Damage Score 0.0699 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a C2H2-type zinc finger protein and is closely related to BCL11A, a gene whose translocation may be associated with B-cell malignancies. Although the specific function of this gene has not been determined, the encoded protein is known to be a transcriptional repressor, and is regulated by the NURD nucleosome remodeling and histone deacetylase complex. Four alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Aug 2013]
PHENOTYPE: Animals homozygous for a mutation of this gene are born with open eyes, exhibit abnormalities of the thymus, and die within 1 day after birth. Mice heterozygous for a hypomorphic allele and a knock-out allele exhibit lethality at weaning due to maxillaryincisor hyperplasia. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, knock-out(2) Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy5 T C 16: 35,303,716 L1255P probably damaging Het
Agl T A 3: 116,791,033 I213F probably damaging Het
Arap2 A G 5: 62,748,857 V273A probably benign Het
Asb18 T A 1: 89,992,985 H149L probably damaging Het
Axdnd1 T C 1: 156,341,870 T809A probably damaging Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Cyp2a5 A G 7: 26,842,985 I471V possibly damaging Het
Dmtf1 G T 5: 9,129,316 T206K probably damaging Het
Dner G T 1: 84,384,026 Q621K probably damaging Het
Fam92a G C 4: 12,157,767 probably null Het
Gmppa A G 1: 75,441,756 Y261C probably benign Het
Lama5 C T 2: 180,183,067 R2519K probably damaging Het
Mical2 G T 7: 112,311,423 A267S probably damaging Het
Nrxn3 A T 12: 89,255,101 D550V probably damaging Het
Olfr351 T A 2: 36,859,947 M134L probably benign Het
Pole A T 5: 110,289,795 D73V probably damaging Het
Ppm1b G A 17: 85,013,846 R472K probably benign Het
Ppm1m A G 9: 106,198,675 I18T probably benign Het
Psg18 C T 7: 18,349,193 G225R probably damaging Het
R3hcc1l T G 19: 42,562,625 Y20* probably null Het
Rapgef1 T C 2: 29,724,856 I817T probably damaging Het
Rasal3 T C 17: 32,403,439 E4G probably benign Het
Ryr1 A T 7: 29,053,090 V3598E probably damaging Het
Slc15a4 A T 5: 127,596,682 V556E possibly damaging Het
Spats2l A G 1: 57,900,766 K193R probably damaging Het
Tacc2 G A 7: 130,625,496 E1323K possibly damaging Het
Tbc1d21 T A 9: 58,363,069 D141V probably damaging Het
Tedc1 G T 12: 113,156,467 probably benign Het
Terf2 A C 8: 107,079,384 L312R possibly damaging Het
Tmem132d A C 5: 127,792,474 S599A probably benign Het
Trp53bp2 T C 1: 182,453,782 F983L probably damaging Het
Ubxn2a T A 12: 4,891,322 K95* probably null Het
Ugt2a2 A T 5: 87,474,469 N213K probably damaging Het
Xpo6 T C 7: 126,104,721 N1086D probably damaging Het
Zbed5 A T 5: 129,902,146 H312L possibly damaging Het
Zfp729b A G 13: 67,593,466 Y227H probably damaging Het
Other mutations in Bcl11b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Bcl11b APN 12 107965815 missense possibly damaging 0.46
IGL02492:Bcl11b APN 12 107915686 missense probably damaging 0.98
IGL02559:Bcl11b APN 12 107915394 utr 3 prime probably benign
IGL02950:Bcl11b APN 12 107989806 missense probably benign 0.00
R0055:Bcl11b UTSW 12 107965777 missense probably benign 0.02
R0762:Bcl11b UTSW 12 107965663 intron probably benign
R1549:Bcl11b UTSW 12 107917163 missense probably damaging 0.97
R1682:Bcl11b UTSW 12 107916649 missense probably damaging 1.00
R2269:Bcl11b UTSW 12 107915651 missense possibly damaging 0.71
R2495:Bcl11b UTSW 12 107915447 missense possibly damaging 0.46
R4094:Bcl11b UTSW 12 107916835 missense probably damaging 1.00
R4095:Bcl11b UTSW 12 107916835 missense probably damaging 1.00
R4155:Bcl11b UTSW 12 107917425 splice site probably null
R4156:Bcl11b UTSW 12 107917425 splice site probably null
R4157:Bcl11b UTSW 12 107917425 splice site probably null
R4611:Bcl11b UTSW 12 107916530 missense probably damaging 0.97
R4900:Bcl11b UTSW 12 107989698 missense probably damaging 1.00
R4906:Bcl11b UTSW 12 107916709 missense probably damaging 1.00
R4982:Bcl11b UTSW 12 107965772 nonsense probably null
R5108:Bcl11b UTSW 12 107965726 missense probably benign 0.04
R5190:Bcl11b UTSW 12 107989716 missense probably damaging 1.00
R6380:Bcl11b UTSW 12 108003101 missense probably benign 0.20
R6423:Bcl11b UTSW 12 107915419 missense possibly damaging 0.82
R6792:Bcl11b UTSW 12 107989734 missense probably damaging 1.00
R7026:Bcl11b UTSW 12 107916592 missense probably damaging 0.99
R7074:Bcl11b UTSW 12 107989507 missense probably benign 0.01
R7371:Bcl11b UTSW 12 107989491 missense probably damaging 1.00
R7454:Bcl11b UTSW 12 107916208 missense possibly damaging 0.93
R7590:Bcl11b UTSW 12 108003143 start codon destroyed probably benign 0.21
R8005:Bcl11b UTSW 12 107916197 missense probably benign
X0018:Bcl11b UTSW 12 107989689 missense probably damaging 1.00
X0021:Bcl11b UTSW 12 107916877 missense probably damaging 0.97
Z1177:Bcl11b UTSW 12 107989740 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGTACTCACATGTGTCGCTGC -3'
(R):5'- TCGAGCTTCAGCATGGACTC -3'

Sequencing Primer
(F):5'- ACCCAGGTGAGGTGTGCTG -3'
(R):5'- TTCAGCATGGACTCGGAGCTG -3'
Posted On2015-02-05