Incidental Mutation 'R3545:F11r'
ID268152
Institutional Source Beutler Lab
Gene Symbol F11r
Ensembl Gene ENSMUSG00000038235
Gene NameF11 receptor
SynonymsJcam1, JAM-A, Ly106, ESTM33, BV11 antigen, JAM-1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock #R3545 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location171437535-171464603 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 171461261 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 149 (V149A)
Ref Sequence ENSEMBL: ENSMUSP00000041907 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043839]
PDB Structure
SOLUBLE PART OF THE JUNCTION ADHESION MOLECULE FROM MOUSE [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000043839
AA Change: V149A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000041907
Gene: ENSMUSG00000038235
AA Change: V149A

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
IGv 44 110 9.93e-8 SMART
IGc2 143 219 1.82e-6 SMART
transmembrane domain 239 261 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144497
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155913
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Tight junctions represent one mode of cell-to-cell adhesion in epithelial or endothelial cell sheets, forming continuous seals around cells and serving as a physical barrier to prevent solutes and water from passing freely through the paracellular space. The protein encoded by this immunoglobulin superfamily gene member is an important regulator of tight junction assembly in epithelia. In addition, the encoded protein can act as (1) a receptor for reovirus, (2) a ligand for the integrin LFA1, involved in leukocyte transmigration, and (3) a platelet receptor. Multiple 5' alternatively spliced variants, encoding the same protein, have been identified but their biological validity has not been established. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display increased dendritic cell migratory ability and contact hypersensitivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd28 A G 14: 31,715,260 L646S probably benign Het
Clip1 A G 5: 123,631,078 L532P probably damaging Het
Efl1 A T 7: 82,762,810 E802D probably benign Het
Fam103a1 T A 7: 81,768,522 probably null Het
Fhit T C 14: 9,870,095 T125A probably benign Het
Fmn2 A G 1: 174,502,626 D194G unknown Het
Gdi1 T A X: 74,307,808 F175L possibly damaging Het
Herc3 T C 6: 58,856,685 S186P probably damaging Het
Hexa A G 9: 59,557,298 N157S probably damaging Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Lig1 T A 7: 13,292,163 N281K possibly damaging Het
Lrp1b A T 2: 40,600,288 L287H probably damaging Het
Mcf2 T C X: 60,135,446 K74R probably damaging Het
Nat1 A G 8: 67,491,032 D23G possibly damaging Het
Nbeal1 T C 1: 60,278,780 F1959L probably damaging Het
Ncf1 T A 5: 134,226,609 K143* probably null Het
Nid2 T A 14: 19,763,711 Y195N probably damaging Het
Nlrp9a T C 7: 26,557,332 I125T probably benign Het
Nme7 T C 1: 164,385,782 F343S probably damaging Het
Otud4 A G 8: 79,665,055 E443G probably damaging Het
Palld G T 8: 61,550,078 A329E possibly damaging Het
Pask A T 1: 93,317,115 V1095D probably damaging Het
Pdzd2 C T 15: 12,375,471 R1526Q probably benign Het
Prkcq A G 2: 11,283,816 K527E probably benign Het
Reln A G 5: 22,227,600 V134A possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sept9 T C 11: 117,352,673 I350T probably damaging Het
Slc16a7 T A 10: 125,294,700 K39* probably null Het
Spata32 T C 11: 103,210,744 E21G possibly damaging Het
Tbc1d1 G A 5: 64,286,007 R523Q probably damaging Het
Thnsl1 T G 2: 21,212,627 D397E probably benign Het
Tubal3 T G 13: 3,933,560 *447G probably null Het
Uprt T A X: 104,483,328 L123H probably damaging Het
Usp9x T C X: 13,128,390 L940P probably benign Het
Other mutations in F11r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00771:F11r APN 1 171462942 critical splice donor site probably null
IGL01431:F11r APN 1 171462909 missense probably damaging 1.00
R0481:F11r UTSW 1 171461279 missense probably benign 0.02
R0486:F11r UTSW 1 171460588 missense probably damaging 1.00
R1944:F11r UTSW 1 171461891 missense probably damaging 1.00
R1984:F11r UTSW 1 171461870 missense probably benign 0.02
R2423:F11r UTSW 1 171461623 missense possibly damaging 0.89
R3840:F11r UTSW 1 171460889 missense probably damaging 1.00
R3841:F11r UTSW 1 171460889 missense probably damaging 1.00
R4007:F11r UTSW 1 171461348 missense probably benign 0.35
R4744:F11r UTSW 1 171460598 missense probably benign 0.00
R4775:F11r UTSW 1 171461641 missense probably damaging 1.00
R6384:F11r UTSW 1 171460940 missense probably benign 0.01
R8052:F11r UTSW 1 171461623 missense possibly damaging 0.89
R8215:F11r UTSW 1 171463088 makesense probably null
R8217:F11r UTSW 1 171463088 makesense probably null
R8377:F11r UTSW 1 171437543 start gained probably benign
RF063:F11r UTSW 1 171461190 critical splice acceptor site probably benign
Predicted Primers PCR Primer
(F):5'- GTTTGATAGGACCTAAGGGCATG -3'
(R):5'- TCAGGGGTCTTATGACTGGC -3'

Sequencing Primer
(F):5'- ACCTAAGGGCATGCGGGTG -3'
(R):5'- GGTCTTATGACTGGCCCCCAC -3'
Posted On2015-02-19