Incidental Mutation 'R3840:F11r'
ID277090
Institutional Source Beutler Lab
Gene Symbol F11r
Ensembl Gene ENSMUSG00000038235
Gene NameF11 receptor
SynonymsJcam1, JAM-A, Ly106, ESTM33, BV11 antigen, JAM-1
MMRRC Submission 040780-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.171) question?
Stock #R3840 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location171437535-171464603 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 171460889 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 100 (R100L)
Ref Sequence ENSEMBL: ENSMUSP00000041907 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043839]
PDB Structure
SOLUBLE PART OF THE JUNCTION ADHESION MOLECULE FROM MOUSE [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000043839
AA Change: R100L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041907
Gene: ENSMUSG00000038235
AA Change: R100L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
IGv 44 110 9.93e-8 SMART
IGc2 143 219 1.82e-6 SMART
transmembrane domain 239 261 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144497
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155913
Meta Mutation Damage Score 0.5827 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Tight junctions represent one mode of cell-to-cell adhesion in epithelial or endothelial cell sheets, forming continuous seals around cells and serving as a physical barrier to prevent solutes and water from passing freely through the paracellular space. The protein encoded by this immunoglobulin superfamily gene member is an important regulator of tight junction assembly in epithelia. In addition, the encoded protein can act as (1) a receptor for reovirus, (2) a ligand for the integrin LFA1, involved in leukocyte transmigration, and (3) a platelet receptor. Multiple 5' alternatively spliced variants, encoding the same protein, have been identified but their biological validity has not been established. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display increased dendritic cell migratory ability and contact hypersensitivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik A T 18: 6,620,104 K11N probably benign Het
Abcc8 A G 7: 46,108,100 I1375T possibly damaging Het
Ate1 A T 7: 130,516,137 D39E probably damaging Het
BC035947 G T 1: 78,497,845 N683K probably benign Het
C530008M17Rik A T 5: 76,859,011 Q1073L unknown Het
Cdca2 A T 14: 67,680,271 Y559* probably null Het
Cmya5 A G 13: 93,094,632 V1316A probably damaging Het
Cntnap5b C T 1: 100,383,477 T936I possibly damaging Het
Col6a5 T C 9: 105,928,611 N1032S unknown Het
Elmsan1 T C 12: 84,171,609 R526G probably damaging Het
Epc2 A G 2: 49,488,738 K68R probably damaging Het
Erbb3 A T 10: 128,570,324 F1075I probably benign Het
Fam171b C A 2: 83,880,062 Q693K possibly damaging Het
Fam198b T A 3: 79,908,590 D302E probably benign Het
Fam83c C T 2: 155,834,748 R34H probably benign Het
Fmn2 GAAGA GAAGAAAGA 1: 174,582,033 probably null Het
Ggt1 T A 10: 75,581,385 Y5* probably null Het
Hsph1 T A 5: 149,620,715 probably null Het
Jhy T A 9: 40,944,846 E115V probably benign Het
Kcnu1 G T 8: 25,885,352 V365L possibly damaging Het
Lrrc4c A G 2: 97,630,192 T388A probably damaging Het
Mastl T C 2: 23,140,551 D202G probably damaging Het
Medag T A 5: 149,427,423 I121N probably damaging Het
Mocos C T 18: 24,676,624 A428V probably damaging Het
Mok C T 12: 110,815,157 V59M probably benign Het
Neb C A 2: 52,207,660 probably null Het
Nr2c2 C T 6: 92,163,138 R464W probably damaging Het
Olfr129 A G 17: 38,055,348 S73P probably damaging Het
Olfr593 G A 7: 103,212,693 G267R probably damaging Het
Otud1 G T 2: 19,658,743 E228* probably null Het
Pcdhga11 A T 18: 37,757,549 N537Y probably damaging Het
Pkd1l1 T C 11: 8,889,050 Y878C probably damaging Het
Podxl C T 6: 31,523,081 V485I probably damaging Het
Psmd12 T C 11: 107,485,572 I44T probably benign Het
Rap1gap T C 4: 137,717,447 F182S probably damaging Het
Slc22a13 T C 9: 119,208,789 D91G probably benign Het
Slc4a11 A G 2: 130,688,054 F268S probably damaging Het
Snap91 C T 9: 86,839,565 V74M probably damaging Het
Tmem87b T A 2: 128,826,384 L150* probably null Het
Tmprss7 T A 16: 45,660,832 R664* probably null Het
Tnfrsf11b T A 15: 54,252,082 H373L probably damaging Het
Tnfrsf23 A G 7: 143,681,529 S33P probably benign Het
Tro A G X: 150,646,202 probably benign Het
Tulp1 A G 17: 28,353,715 V489A probably damaging Het
Wac C A 18: 7,918,535 P416H probably damaging Het
Zap70 T A 1: 36,778,417 I247N probably damaging Het
Zfp617 G A 8: 71,932,117 G97E probably damaging Het
Other mutations in F11r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00771:F11r APN 1 171462942 critical splice donor site probably null
IGL01431:F11r APN 1 171462909 missense probably damaging 1.00
R0481:F11r UTSW 1 171461279 missense probably benign 0.02
R0486:F11r UTSW 1 171460588 missense probably damaging 1.00
R1944:F11r UTSW 1 171461891 missense probably damaging 1.00
R1984:F11r UTSW 1 171461870 missense probably benign 0.02
R2423:F11r UTSW 1 171461623 missense possibly damaging 0.89
R3545:F11r UTSW 1 171461261 missense probably damaging 1.00
R3841:F11r UTSW 1 171460889 missense probably damaging 1.00
R4007:F11r UTSW 1 171461348 missense probably benign 0.35
R4744:F11r UTSW 1 171460598 missense probably benign 0.00
R4775:F11r UTSW 1 171461641 missense probably damaging 1.00
R6384:F11r UTSW 1 171460940 missense probably benign 0.01
R8052:F11r UTSW 1 171461623 missense possibly damaging 0.89
R8215:F11r UTSW 1 171463088 makesense probably null
R8217:F11r UTSW 1 171463088 makesense probably null
R8377:F11r UTSW 1 171437543 start gained probably benign
RF063:F11r UTSW 1 171461190 critical splice acceptor site probably benign
Predicted Primers PCR Primer
(F):5'- AGTAATCGACACTGCCCAGC -3'
(R):5'- CTTAGGTCCTATCAAACCAGGG -3'

Sequencing Primer
(F):5'- ACACTGCCCAGCCTGGATTC -3'
(R):5'- TCCTATCAAACCAGGGGGCTC -3'
Posted On2015-04-06