Incidental Mutation 'R3754:Lrrc72'
ID271362
Institutional Source Beutler Lab
Gene Symbol Lrrc72
Ensembl Gene ENSMUSG00000020545
Gene Nameleucine rich repeat containing 72
Synonyms1700108M19Rik, 4933421E18Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R3754 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location36208345-36253398 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36212568 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 42 (S42P)
Ref Sequence ENSEMBL: ENSMUSP00000020853 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020853] [ENSMUST00000122115] [ENSMUST00000221155]
Predicted Effect probably benign
Transcript: ENSMUST00000020853
AA Change: S42P

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000122115
AA Change: S94P

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000113517
Gene: ENSMUSG00000020545
AA Change: S94P

DomainStartEndE-ValueType
Pfam:LRR_9 1 69 6.6e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152817
Predicted Effect probably benign
Transcript: ENSMUST00000221155
AA Change: S224P

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221665
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222145
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asap3 T C 4: 136,229,455 probably null Het
Atp12a G A 14: 56,372,588 V182I probably benign Het
Gad2 A T 2: 22,681,340 D430V possibly damaging Het
Gm9833 G A 3: 10,088,515 V115I possibly damaging Het
Hr A G 14: 70,567,824 E1002G probably damaging Het
Itpkc G T 7: 27,228,432 P19Q probably damaging Het
Med1 A G 11: 98,166,722 V318A possibly damaging Het
Nek11 A T 9: 105,314,718 N164K probably damaging Het
Neurod2 A G 11: 98,327,700 S213P probably damaging Het
Nhsl1 A G 10: 18,516,034 N179D probably damaging Het
Nr2f2 T C 7: 70,358,021 I238V probably benign Het
Rpl37 C A 15: 5,117,288 T2K possibly damaging Het
Slf2 A G 19: 44,973,237 D1065G probably benign Het
Smim5 T C 11: 115,905,723 C57R probably damaging Het
Soat2 T A 15: 102,157,078 V236D probably damaging Het
Teddm3 C T 16: 21,153,148 D224N possibly damaging Het
Tm2d2 G A 8: 25,020,478 V118I probably damaging Het
Ttc22 C A 4: 106,639,081 R443S probably damaging Het
Upf1 A G 8: 70,339,814 I368T probably benign Het
Xrn1 G T 9: 95,967,788 D129Y probably damaging Het
Zfp109 A G 7: 24,229,756 M76T probably benign Het
Znrf1 G A 8: 111,619,211 V76M probably damaging Het
Other mutations in Lrrc72
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00861:Lrrc72 APN 12 36221508 missense probably benign 0.01
IGL01573:Lrrc72 APN 12 36212562 splice site probably null
R1905:Lrrc72 UTSW 12 36208662 splice site probably null
R4429:Lrrc72 UTSW 12 36208624 missense probably damaging 1.00
R6263:Lrrc72 UTSW 12 36208604 nonsense probably null
R6895:Lrrc72 UTSW 12 36209718 missense probably damaging 0.99
R7263:Lrrc72 UTSW 12 36208612 missense probably damaging 1.00
R7410:Lrrc72 UTSW 12 36222804 missense probably damaging 1.00
R7452:Lrrc72 UTSW 12 36212693 missense probably benign 0.11
R8217:Lrrc72 UTSW 12 36208677 missense probably damaging 1.00
V8831:Lrrc72 UTSW 12 36208657 missense possibly damaging 0.65
Z1177:Lrrc72 UTSW 12 36247693 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CTGAATCATGTAACATGGGTGAGG -3'
(R):5'- TGGTCAGGCAAGGCAGATTG -3'

Sequencing Primer
(F):5'- GGGAAAGCGAAAATTACATTATTCAC -3'
(R):5'- GACTCGGTATGCTTTTGTTAA -3'
Posted On2015-03-18