Incidental Mutation 'R3816:Olfr922'
ID274316
Institutional Source Beutler Lab
Gene Symbol Olfr922
Ensembl Gene ENSMUSG00000043911
Gene Nameolfactory receptor 922
SynonymsGA_x6K02T2PVTD-32518237-32519172, MOR161-3
MMRRC Submission 040881-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R3816 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location38814614-38819195 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38816426 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 308 (K308E)
Ref Sequence ENSEMBL: ENSMUSP00000149057 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051004] [ENSMUST00000213164]
Predicted Effect possibly damaging
Transcript: ENSMUST00000051004
AA Change: K308E

PolyPhen 2 Score 0.468 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000057086
Gene: ENSMUSG00000043911
AA Change: K308E

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 9.3e-52 PFAM
Pfam:7tm_1 41 290 3.4e-26 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213164
AA Change: K308E

PolyPhen 2 Score 0.468 (Sensitivity: 0.89; Specificity: 0.90)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810013L24Rik T A 16: 8,830,494 I12N probably damaging Het
Aak1 T C 6: 86,959,042 probably benign Het
Abca2 A G 2: 25,446,071 Y2151C probably damaging Het
Adamts3 T A 5: 89,705,264 H509L probably damaging Het
Agfg2 T C 5: 137,653,774 D441G probably benign Het
Arl8b T A 6: 108,813,697 V65D probably damaging Het
As3mt A T 19: 46,707,777 D8V probably benign Het
Ass1 G T 2: 31,510,105 probably benign Het
Cdc42bpa A G 1: 180,144,886 I634V possibly damaging Het
Cflar T C 1: 58,752,423 V298A probably benign Het
Csmd1 C T 8: 16,002,522 A2201T probably damaging Het
Cyp4a12b A T 4: 115,432,470 D178V probably damaging Het
Dlec1 C T 9: 119,124,843 A610V probably damaging Het
Dock1 C T 7: 134,744,286 R186* probably null Het
E130018O15Rik T C 5: 35,382,766 noncoding transcript Het
Gabrg3 G A 7: 57,381,664 Q43* probably null Het
Gipc2 T C 3: 152,165,844 K15R probably benign Het
Gjb2 A G 14: 57,100,073 V226A probably benign Het
Glipr2 G T 4: 43,977,522 A51S possibly damaging Het
Gsdme A C 6: 50,219,411 S340A probably benign Het
H2-M10.2 A T 17: 36,286,362 Y20* probably null Het
Hlcs A G 16: 94,133,088 V242A probably benign Het
Ifi44 T C 3: 151,749,257 I110M possibly damaging Het
Il18r1 T C 1: 40,486,972 probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Khk T C 5: 30,926,716 S80P probably damaging Het
Ly9 G T 1: 171,589,085 T537N possibly damaging Het
Muc4 C A 16: 32,754,529 H1468N probably benign Het
Myo1g A G 11: 6,510,926 V706A probably benign Het
Npat T C 9: 53,569,916 S1008P probably damaging Het
Olfr483 A G 7: 108,103,498 Y63C possibly damaging Het
Olfr700 A G 7: 106,805,820 I214T probably damaging Het
Olfr876 C T 9: 37,804,169 S86L probably benign Het
Olfr889 A T 9: 38,116,626 T277S possibly damaging Het
Pcdha2 A G 18: 36,941,695 Y793C probably benign Het
Pcdhb4 A T 18: 37,308,012 D125V probably damaging Het
Pdgfrb A G 18: 61,078,945 D844G probably damaging Het
Phf3 T C 1: 30,805,753 D1375G probably damaging Het
Pigu A T 2: 155,299,143 F276I probably damaging Het
Pomgnt1 T A 4: 116,153,942 probably null Het
Psmd9 C T 5: 123,234,590 probably benign Het
Rac2 T C 15: 78,565,999 D47G possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sall1 G T 8: 89,032,675 A267E probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Serpina3k A G 12: 104,340,962 E151G probably benign Het
Skint5 A G 4: 113,629,122 probably benign Het
Slc51b A G 9: 65,414,018 probably benign Het
Sorl1 A G 9: 42,064,049 L487P possibly damaging Het
Sspo A T 6: 48,481,103 E3269V possibly damaging Het
Star G A 8: 25,809,877 M82I probably benign Het
Tnfrsf11a C T 1: 105,809,360 T64I probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Usp32 A G 11: 84,994,384 probably null Het
Vmn2r18 T C 5: 151,561,683 N782S probably benign Het
Vwa3a A G 7: 120,800,379 T1028A probably benign Het
Xrn2 G A 2: 147,028,200 G270R probably damaging Het
Zbbx G T 3: 75,085,495 Q231K probably benign Het
Other mutations in Olfr922
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01631:Olfr922 APN 9 38816039 missense probably damaging 0.99
IGL02445:Olfr922 APN 9 38815605 missense possibly damaging 0.57
R1758:Olfr922 UTSW 9 38815575 missense probably benign
R1759:Olfr922 UTSW 9 38815898 missense probably damaging 1.00
R1809:Olfr922 UTSW 9 38816147 missense probably benign
R1938:Olfr922 UTSW 9 38815850 missense probably benign 0.33
R2177:Olfr922 UTSW 9 38816186 missense possibly damaging 0.82
R3438:Olfr922 UTSW 9 38816216 missense probably damaging 0.99
R3815:Olfr922 UTSW 9 38816426 missense possibly damaging 0.47
R3817:Olfr922 UTSW 9 38816426 missense possibly damaging 0.47
R3819:Olfr922 UTSW 9 38816426 missense possibly damaging 0.47
R3859:Olfr922 UTSW 9 38816147 missense probably benign
R4768:Olfr922 UTSW 9 38815949 missense probably damaging 1.00
R5082:Olfr922 UTSW 9 38816145 missense possibly damaging 0.70
R5659:Olfr922 UTSW 9 38815776 missense probably benign 0.01
R5813:Olfr922 UTSW 9 38815656 missense probably benign 0.00
R6226:Olfr922 UTSW 9 38816370 missense probably damaging 0.99
R7240:Olfr922 UTSW 9 38815713 missense probably benign 0.01
R7966:Olfr922 UTSW 9 38816240 missense probably benign 0.11
R8751:Olfr922 UTSW 9 38816039 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACTGAAGGCAGATCTAAGGC -3'
(R):5'- TTACGTTTTCTAATACCCTGTCAGG -3'

Sequencing Primer
(F):5'- GGCAGATCTAAGGCTTTCAGC -3'
(R):5'- TTTCAGACCAGGTCAGCT -3'
Posted On2015-04-02