Mutagenetix > Incidental Mutations

Incidental Mutation 'R3816:Usp32'

274322

Institutional Source

Beutler Lab

Gene Symbol

Usp32

Ensembl Gene

ENSMUSG00000000804

Gene Name

ubiquitin specific peptidase 32

Synonyms

6430526O11Rik, 2900074J03Rik

MMRRC Submission

040881-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R3816 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

84984442-85140161 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 84994384 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000103710 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000108075] [ENSMUST00000108075]

Predicted Effect

probably benign
Transcript: ENSMUST00000000821

SMART Domains

Protein: ENSMUSP00000000821
Gene: ENSMUSG00000000804

Domain	Start	End	E-Value	Type
Pfam:UCH	32	260	4.1e-51	PFAM
Pfam:UCH_1	33	228	1.7e-7	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000000821

SMART Domains

Protein: ENSMUSP00000000821
Gene: ENSMUSG00000000804

Domain	Start	End	E-Value	Type
Pfam:UCH	32	260	4.1e-51	PFAM
Pfam:UCH_1	33	228	1.7e-7	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000108075

SMART Domains

Protein: ENSMUSP00000103710
Gene: ENSMUSG00000000804

Domain	Start	End	E-Value	Type
EFh	232	260	4.66e0	SMART
EFh	268	296	5.8e-1	SMART
Blast:EFh	318	346	5e-7	BLAST
DUSP	389	588	2.32e-16	SMART
Pfam:Ubiquitin_3	628	711	2.4e-9	PFAM
Pfam:UCH	733	1564	2.4e-83	PFAM
Pfam:UCH_1	1202	1547	2.9e-12	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000108075

SMART Domains

Protein: ENSMUSP00000103710
Gene: ENSMUSG00000000804

Domain	Start	End	E-Value	Type
EFh	232	260	4.66e0	SMART
EFh	268	296	5.8e-1	SMART
Blast:EFh	318	346	5e-7	BLAST
DUSP	389	588	2.32e-16	SMART
Pfam:Ubiquitin_3	628	711	2.4e-9	PFAM
Pfam:UCH	733	1564	2.4e-83	PFAM
Pfam:UCH_1	1202	1547	2.9e-12	PFAM

Meta Mutation Damage Score

0.9593

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.7%
20x: 96.2%

Validation Efficiency

100% (62/62)

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810013L24Rik	T	A	16: 8,830,494	I12N	probably damaging	Het
Aak1	T	C	6: 86,959,042		probably benign	Het
Abca2	A	G	2: 25,446,071	Y2151C	probably damaging	Het
Adamts3	T	A	5: 89,705,264	H509L	probably damaging	Het
Agfg2	T	C	5: 137,653,774	D441G	probably benign	Het
Arl8b	T	A	6: 108,813,697	V65D	probably damaging	Het
As3mt	A	T	19: 46,707,777	D8V	probably benign	Het
Ass1	G	T	2: 31,510,105		probably benign	Het
Cdc42bpa	A	G	1: 180,144,886	I634V	possibly damaging	Het
Cflar	T	C	1: 58,752,423	V298A	probably benign	Het
Csmd1	C	T	8: 16,002,522	A2201T	probably damaging	Het
Cyp4a12b	A	T	4: 115,432,470	D178V	probably damaging	Het
Dlec1	C	T	9: 119,124,843	A610V	probably damaging	Het
Dock1	C	T	7: 134,744,286	R186*	probably null	Het
E130018O15Rik	T	C	5: 35,382,766		noncoding transcript	Het
Gabrg3	G	A	7: 57,381,664	Q43*	probably null	Het
Gipc2	T	C	3: 152,165,844	K15R	probably benign	Het
Gjb2	A	G	14: 57,100,073	V226A	probably benign	Het
Glipr2	G	T	4: 43,977,522	A51S	possibly damaging	Het
Gsdme	A	C	6: 50,219,411	S340A	probably benign	Het
H2-M10.2	A	T	17: 36,286,362	Y20*	probably null	Het
Hlcs	A	G	16: 94,133,088	V242A	probably benign	Het
Ifi44	T	C	3: 151,749,257	I110M	possibly damaging	Het
Il18r1	T	C	1: 40,486,972		probably benign	Het
Kcnd3	C	T	3: 105,658,766	A421V	probably damaging	Het
Khk	T	C	5: 30,926,716	S80P	probably damaging	Het
Ly9	G	T	1: 171,589,085	T537N	possibly damaging	Het
Muc4	C	A	16: 32,754,529	H1468N	probably benign	Het
Myo1g	A	G	11: 6,510,926	V706A	probably benign	Het
Npat	T	C	9: 53,569,916	S1008P	probably damaging	Het
Olfr483	A	G	7: 108,103,498	Y63C	possibly damaging	Het
Olfr700	A	G	7: 106,805,820	I214T	probably damaging	Het
Olfr876	C	T	9: 37,804,169	S86L	probably benign	Het
Olfr889	A	T	9: 38,116,626	T277S	possibly damaging	Het
Olfr922	A	G	9: 38,816,426	K308E	possibly damaging	Het
Pcdha2	A	G	18: 36,941,695	Y793C	probably benign	Het
Pcdhb4	A	T	18: 37,308,012	D125V	probably damaging	Het
Pdgfrb	A	G	18: 61,078,945	D844G	probably damaging	Het
Phf3	T	C	1: 30,805,753	D1375G	probably damaging	Het
Pigu	A	T	2: 155,299,143	F276I	probably damaging	Het
Pomgnt1	T	A	4: 116,153,942		probably null	Het
Psmd9	C	T	5: 123,234,590		probably benign	Het
Rac2	T	C	15: 78,565,999	D47G	possibly damaging	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Sall1	G	T	8: 89,032,675	A267E	probably benign	Het
Secisbp2l	C	T	2: 125,740,737	G933D	possibly damaging	Het
Serpina3k	A	G	12: 104,340,962	E151G	probably benign	Het
Skint5	A	G	4: 113,629,122		probably benign	Het
Slc51b	A	G	9: 65,414,018		probably benign	Het
Sorl1	A	G	9: 42,064,049	L487P	possibly damaging	Het
Sspo	A	T	6: 48,481,103	E3269V	possibly damaging	Het
Star	G	A	8: 25,809,877	M82I	probably benign	Het
Tnfrsf11a	C	T	1: 105,809,360	T64I	probably damaging	Het
Top2b	T	G	14: 16,409,189	I777M	probably damaging	Het
Vmn2r18	T	C	5: 151,561,683	N782S	probably benign	Het
Vwa3a	A	G	7: 120,800,379	T1028A	probably benign	Het
Xrn2	G	A	2: 147,028,200	G270R	probably damaging	Het
Zbbx	G	T	3: 75,085,495	Q231K	probably benign	Het

Other mutations in Usp32

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00529:Usp32	APN	11	84994426	missense	probably damaging	1.00
IGL00701:Usp32	APN	11	85059125	splice site	probably null
IGL00848:Usp32	APN	11	85051181	splice site	probably benign
IGL00934:Usp32	APN	11	85007076	missense	probably damaging	1.00
IGL01019:Usp32	APN	11	85039265	missense	probably damaging	0.97
IGL01302:Usp32	APN	11	84988482	missense	probably benign	0.05
IGL01444:Usp32	APN	11	85059164	missense	probably damaging	0.97
IGL01575:Usp32	APN	11	85022802	missense	probably damaging	1.00
IGL01981:Usp32	APN	11	85036524	missense	probably benign	0.02
IGL02118:Usp32	APN	11	85032177	nonsense	probably null
IGL02159:Usp32	APN	11	85005802	splice site	probably null
IGL02227:Usp32	APN	11	84986481	missense	probably damaging	1.00
IGL02363:Usp32	APN	11	85044787	missense	probably benign	0.01
IGL02524:Usp32	APN	11	85010011	nonsense	probably null
IGL02613:Usp32	APN	11	85040070	missense	probably damaging	0.99
IGL02720:Usp32	APN	11	85006991	critical splice donor site	probably null
IGL02738:Usp32	APN	11	85083806	missense	probably damaging	1.00
IGL02929:Usp32	APN	11	84988372	missense	probably benign	0.01
IGL03303:Usp32	APN	11	85022832	missense	probably damaging	1.00
BB010:Usp32	UTSW	11	85007059	missense	probably damaging	1.00
BB020:Usp32	UTSW	11	85007059	missense	probably damaging	1.00
PIT4812001:Usp32	UTSW	11	85010074	missense	probably damaging	1.00
R0026:Usp32	UTSW	11	85032074	missense	possibly damaging	0.48
R0295:Usp32	UTSW	11	85053692	missense	probably damaging	0.98
R1320:Usp32	UTSW	11	85017793	missense	probably damaging	0.98
R1712:Usp32	UTSW	11	85042580	missense	probably benign	0.12
R1922:Usp32	UTSW	11	85007004	nonsense	probably null
R1973:Usp32	UTSW	11	85103931	missense	probably benign	0.09
R2010:Usp32	UTSW	11	85040004	missense	probably damaging	0.98
R2082:Usp32	UTSW	11	85030512	missense	probably damaging	0.99
R2355:Usp32	UTSW	11	85005909	missense	probably benign	0.34
R3147:Usp32	UTSW	11	85029087	missense	probably damaging	1.00
R3160:Usp32	UTSW	11	85025536	missense	probably damaging	0.97
R3162:Usp32	UTSW	11	85025536	missense	probably damaging	0.97
R3716:Usp32	UTSW	11	85042563	missense	probably damaging	1.00
R3870:Usp32	UTSW	11	85007055	nonsense	probably null
R3871:Usp32	UTSW	11	85081156	missense	probably null	0.81
R4041:Usp32	UTSW	11	85017739	missense	probably benign	0.40
R4079:Usp32	UTSW	11	85039229	missense	probably damaging	0.98
R4332:Usp32	UTSW	11	85103978	missense	possibly damaging	0.79
R4396:Usp32	UTSW	11	85053975	missense	probably benign
R4580:Usp32	UTSW	11	85059127	critical splice donor site	probably null
R4620:Usp32	UTSW	11	85059127	critical splice donor site	probably null
R4744:Usp32	UTSW	11	84994393	missense	probably damaging	1.00
R4909:Usp32	UTSW	11	85055772	nonsense	probably null
R5056:Usp32	UTSW	11	85026795	missense	probably benign	0.07
R5111:Usp32	UTSW	11	85077331	missense	possibly damaging	0.95
R5213:Usp32	UTSW	11	85022259	missense	probably damaging	1.00
R5308:Usp32	UTSW	11	85017718	missense	probably benign	0.12
R5381:Usp32	UTSW	11	85059127	critical splice donor site	probably benign
R5538:Usp32	UTSW	11	85017786	missense	possibly damaging	0.65
R5659:Usp32	UTSW	11	85077414	missense	possibly damaging	0.94
R6006:Usp32	UTSW	11	84992451	critical splice donor site	probably null
R6011:Usp32	UTSW	11	85032097	missense	possibly damaging	0.70
R6029:Usp32	UTSW	11	85025582	missense	probably damaging	0.99
R6074:Usp32	UTSW	11	84994573	missense	probably benign	0.00
R6331:Usp32	UTSW	11	84986576	missense	possibly damaging	0.92
R6353:Usp32	UTSW	11	85022281	missense	probably benign
R6714:Usp32	UTSW	11	85026870	missense	probably damaging	0.99
R6778:Usp32	UTSW	11	85025686	missense	probably benign	0.00
R6988:Usp32	UTSW	11	85010143	missense	probably benign	0.35
R6992:Usp32	UTSW	11	85032088	missense	probably damaging	0.99
R7182:Usp32	UTSW	11	85040170	missense	probably benign	0.34
R7186:Usp32	UTSW	11	85051234	missense	probably benign	0.45
R7198:Usp32	UTSW	11	85022855	frame shift	probably null
R7201:Usp32	UTSW	11	85022855	frame shift	probably null
R7469:Usp32	UTSW	11	84988553	missense	possibly damaging	0.94
R7502:Usp32	UTSW	11	85022898	missense	possibly damaging	0.48
R7513:Usp32	UTSW	11	85027112	nonsense	probably null
R7629:Usp32	UTSW	11	85019855	frame shift	probably null
R7703:Usp32	UTSW	11	85077327	missense	probably damaging	0.99
R7741:Usp32	UTSW	11	84987281	missense	probably damaging	0.99
R7765:Usp32	UTSW	11	84994408	missense	probably damaging	1.00
R7933:Usp32	UTSW	11	85007059	missense	probably damaging	1.00
R7973:Usp32	UTSW	11	85022808	missense	probably damaging	0.99
R7989:Usp32	UTSW	11	85034300	missense
R7998:Usp32	UTSW	11	84994426	missense	probably damaging	1.00
R8292:Usp32	UTSW	11	85077401	missense	probably damaging	0.99
R8305:Usp32	UTSW	11	85032185	missense	possibly damaging	0.83
R8548:Usp32	UTSW	11	85017827	missense	possibly damaging	0.52
X0028:Usp32	UTSW	11	84992606	missense	probably benign	0.05
Z1177:Usp32	UTSW	11	84988612	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TCAGCCTCTCACATTCTGGG -3'
(R):5'- GGCTAGGTGTTCATTTTAAATGCC -3'

Sequencing Primer
(F):5'- GCCTCTCACATTCTGGGATTAAAGG -3'
(R):5'- CCCCCTCTAATAGGTTGTAGAGGAG -3'

Posted On

2015-04-02