Incidental Mutation 'R3857:Bdkrb2'
ID276223
Institutional Source Beutler Lab
Gene Symbol Bdkrb2
Ensembl Gene ENSMUSG00000021070
Gene Namebradykinin receptor, beta 2
Synonymskinin B2, B2R, B(2), B2, BK2R
MMRRC Submission 040785-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R3857 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location105563226-105595237 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105592439 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 313 (V313A)
Ref Sequence ENSEMBL: ENSMUSP00000001652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001652]
Predicted Effect probably benign
Transcript: ENSMUST00000001652
AA Change: V313A

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000001652
Gene: ENSMUSG00000021070
AA Change: V313A

DomainStartEndE-ValueType
Pfam:7tm_1 75 333 8.8e-56 PFAM
Meta Mutation Damage Score 0.1215 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.6%
  • 10x: 96.7%
  • 20x: 92.4%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for bradykinin. The 9 aa bradykinin peptide elicits many responses including vasodilation, edema, smooth muscle spasm and pain fiber stimulation. This receptor associates with G proteins that stimulate a phosphatidylinositol-calcium second messenger system. Alternate start codons result in two isoforms of the protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are indistinguishable from normal littermates, but bradykinin response is eliminated in ileum, uterus, and cervical ganglia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AU022751 A G X: 6,082,656 S102P possibly damaging Het
Ccng1 A G 11: 40,753,833 L79P probably damaging Het
Celf1 A G 2: 91,012,741 E411G probably damaging Het
Cps1 A G 1: 67,168,278 Y582C probably damaging Het
Dnah8 A G 17: 30,663,422 D656G probably damaging Het
Erc2 A G 14: 28,475,642 probably benign Het
Ercc8 A G 13: 108,194,114 E395G possibly damaging Het
F13a1 A G 13: 37,025,694 L99P probably benign Het
Fzd3 A T 14: 65,239,839 C89S possibly damaging Het
Gm2075 T A 12: 88,012,246 D133E unknown Het
Gse1 T A 8: 120,571,133 probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hs3st1 G A 5: 39,614,913 T129I probably damaging Het
Irx1 A T 13: 71,963,458 Y11N possibly damaging Het
Kdm3b T A 18: 34,833,387 I1658N probably benign Het
Mtmr4 G A 11: 87,597,262 V24M probably damaging Het
Nfatc1 T C 18: 80,665,275 probably benign Het
Obscn A G 11: 59,080,969 probably benign Het
Pcna A T 2: 132,249,621 S261T probably benign Het
Pigr T C 1: 130,847,261 V475A probably benign Het
Pitpnc1 T C 11: 107,320,805 probably null Het
Psph A G 5: 129,771,476 M47T probably damaging Het
Pth2r A T 1: 65,322,047 I52F probably damaging Het
Rtn4rl2 A G 2: 84,880,386 probably null Het
Senp6 A G 9: 80,092,321 T7A possibly damaging Het
Slc4a1 A T 11: 102,357,121 V349E probably benign Het
Spice1 T C 16: 44,355,443 S2P probably damaging Het
Spty2d1 G A 7: 46,998,296 T295I probably benign Het
Thsd7a C T 6: 12,555,226 G220S probably benign Het
Togaram1 A G 12: 64,980,859 Q874R possibly damaging Het
Ttn T A 2: 76,908,975 D3740V probably benign Het
Unc13c G T 9: 73,699,108 Y1323* probably null Het
Vmn1r19 A T 6: 57,405,113 Y217F possibly damaging Het
Zfp101 G T 17: 33,382,431 S79* probably null Het
Zfp512 G T 5: 31,472,840 R222L probably damaging Het
Zfyve16 A T 13: 92,494,971 I1372N probably damaging Het
Other mutations in Bdkrb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Bdkrb2 APN 12 105588303 splice site probably benign
IGL00703:Bdkrb2 APN 12 105592355 missense probably benign 0.04
R0465:Bdkrb2 UTSW 12 105591859 missense possibly damaging 0.89
R1082:Bdkrb2 UTSW 12 105592592 missense probably benign 0.00
R1171:Bdkrb2 UTSW 12 105592157 missense probably benign
R1589:Bdkrb2 UTSW 12 105591859 missense possibly damaging 0.94
R2265:Bdkrb2 UTSW 12 105592225 missense probably benign 0.00
R3404:Bdkrb2 UTSW 12 105592496 missense possibly damaging 0.90
R3406:Bdkrb2 UTSW 12 105592496 missense possibly damaging 0.90
R4761:Bdkrb2 UTSW 12 105588278 missense probably benign 0.00
R4833:Bdkrb2 UTSW 12 105591658 missense probably benign 0.10
R6916:Bdkrb2 UTSW 12 105591779 missense probably damaging 0.96
R7358:Bdkrb2 UTSW 12 105592541 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- AGCGTCATCACCTTCTGCAC -3'
(R):5'- AGGTTCTCAAAGTCCCCATG -3'

Sequencing Primer
(F):5'- CATCTTGCAGGTGCTGAGGAAC -3'
(R):5'- CATGGAGTTCTCCATCTGGACG -3'
Posted On2015-04-06