Incidental Mutation 'R3841:Tbpl1'
ID 277167
Institutional Source Beutler Lab
Gene Symbol Tbpl1
Ensembl Gene ENSMUSG00000071359
Gene Name TATA box binding protein-like 1
Synonyms Tlp, TRF2, TLF, TRP
MMRRC Submission 040781-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.895) question?
Stock # R3841 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 22579778-22607837 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to G at 22587807 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114223 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095794] [ENSMUST00000127698]
AlphaFold P62340
Predicted Effect probably benign
Transcript: ENSMUST00000095794
SMART Domains Protein: ENSMUSP00000093470
Gene: ENSMUSG00000071359

DomainStartEndE-ValueType
Pfam:TBP 8 92 8.3e-24 PFAM
Pfam:TBP 97 182 4.5e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127698
SMART Domains Protein: ENSMUSP00000114223
Gene: ENSMUSG00000071359

DomainStartEndE-ValueType
Pfam:TBP 10 91 2.4e-25 PFAM
Pfam:TBP 99 181 1.8e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138022
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the TATA box-binding protein family. TATA box-binding proteins play a critical role in transcription by RNA polymerase II as components of the transcription factor IID (TFIID) complex. The encoded protein does not bind to the TATA box and initiates transcription from TATA-less promoters. This gene plays a critical role in spermatogenesis, and single nucleotide polymorphisms in this gene may be associated with male infertility. Alternatively spliced transcript variants have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 3. [provided by RefSeq, Nov 2011]
PHENOTYPE: Males homozygous for targeted null mutations are sterile due to a block in spermiogenesis. Spermatids exhibit defective acrosome formation, fragmentation of the chromocenter, and develop at most to step 7 of differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik A T 18: 6,620,104 (GRCm39) K11N probably benign Het
Atp8b3 A G 10: 80,365,540 (GRCm39) F405L possibly damaging Het
BC035947 G T 1: 78,474,482 (GRCm39) N683K probably benign Het
Bmper T A 9: 23,384,727 (GRCm39) probably null Het
Btnl7-ps A G 17: 34,761,550 (GRCm39) noncoding transcript Het
Cmya5 A G 13: 93,231,140 (GRCm39) V1316A probably damaging Het
Cracd A T 5: 77,006,858 (GRCm39) Q1073L unknown Het
Dgcr6 C A 16: 17,888,077 (GRCm39) Y200* probably null Het
Dsp A C 13: 38,381,681 (GRCm39) I2210L probably benign Het
Eef1e1 G A 13: 38,840,167 (GRCm39) T46I probably damaging Het
Epc2 A G 2: 49,378,750 (GRCm39) K68R probably damaging Het
F11r G T 1: 171,288,457 (GRCm39) R100L probably damaging Het
Fam83c C T 2: 155,676,668 (GRCm39) R34H probably benign Het
Fbxw25 A T 9: 109,491,202 (GRCm39) Y105* probably null Het
Ggt1 T A 10: 75,417,219 (GRCm39) Y5* probably null Het
Hipk2 T C 6: 38,795,861 (GRCm39) E136G probably damaging Het
Hsph1 T A 5: 149,544,180 (GRCm39) probably null Het
Impdh1 A G 6: 29,202,768 (GRCm39) S421P probably damaging Het
Jhy T A 9: 40,856,142 (GRCm39) E115V probably benign Het
Kmt2a T C 9: 44,742,588 (GRCm39) probably benign Het
Ldlrap1 T C 4: 134,477,747 (GRCm39) T159A probably damaging Het
Lrrc4c A G 2: 97,460,537 (GRCm39) T388A probably damaging Het
Map3k10 C A 7: 27,357,789 (GRCm39) C663F possibly damaging Het
Me3 A T 7: 89,435,701 (GRCm39) N179Y possibly damaging Het
Medag T A 5: 149,350,888 (GRCm39) I121N probably damaging Het
Mocos C T 18: 24,809,681 (GRCm39) A428V probably damaging Het
Mok C T 12: 110,781,591 (GRCm39) V59M probably benign Het
Neb C A 2: 52,097,672 (GRCm39) probably null Het
Nr2c2 C T 6: 92,140,119 (GRCm39) R464W probably damaging Het
Or52s1 G A 7: 102,861,900 (GRCm39) G267R probably damaging Het
Or6c35 A G 10: 129,169,202 (GRCm39) I151V probably benign Het
Otud1 G T 2: 19,663,554 (GRCm39) E228* probably null Het
Parp4 A T 14: 56,825,235 (GRCm39) N120Y probably damaging Het
Ptprb T C 10: 116,182,887 (GRCm39) V1521A possibly damaging Het
Rap1gap T C 4: 137,444,758 (GRCm39) F182S probably damaging Het
Rcan2 A G 17: 44,347,870 (GRCm39) K193R probably benign Het
Rdh19 A T 10: 127,692,755 (GRCm39) M141L probably benign Het
Selenok C T 14: 29,695,337 (GRCm39) R72* probably null Het
Tnxb A G 17: 34,917,897 (GRCm39) E2270G possibly damaging Het
Tulp1 A G 17: 28,572,689 (GRCm39) V489A probably damaging Het
Utp20 A T 10: 88,611,065 (GRCm39) probably benign Het
Zfp617 G A 8: 72,685,961 (GRCm39) G97E probably damaging Het
Zfp773 A G 7: 7,135,390 (GRCm39) V402A possibly damaging Het
Other mutations in Tbpl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02385:Tbpl1 APN 10 22,583,568 (GRCm39) missense probably damaging 1.00
R0173:Tbpl1 UTSW 10 22,583,523 (GRCm39) nonsense probably null
R1777:Tbpl1 UTSW 10 22,583,742 (GRCm39) missense probably damaging 1.00
R2018:Tbpl1 UTSW 10 22,583,576 (GRCm39) missense probably damaging 0.99
R2019:Tbpl1 UTSW 10 22,583,576 (GRCm39) missense probably damaging 0.99
R2365:Tbpl1 UTSW 10 22,581,785 (GRCm39) missense possibly damaging 0.93
R6598:Tbpl1 UTSW 10 22,583,748 (GRCm39) missense probably damaging 0.99
R9437:Tbpl1 UTSW 10 22,587,838 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTAGGGTATACAGCCACCAAG -3'
(R):5'- TCTCCCAGGATGTGATCTTCGTG -3'

Sequencing Primer
(F):5'- AGATGCAAAGTCAGTCCTATCTC -3'
(R):5'- ATGTGATCTTCGTGGTGGGAAC -3'
Posted On 2015-04-06