Incidental Mutation 'R3957:Plod3'
ID310753
Institutional Source Beutler Lab
Gene Symbol Plod3
Ensembl Gene ENSMUSG00000004846
Gene Nameprocollagen-lysine, 2-oxoglutarate 5-dioxygenase 3
Synonymslysyl hydroxylase 3, LH3
MMRRC Submission 040931-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3957 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location136987019-136996648 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 136994192 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 616 (H616L)
Ref Sequence ENSEMBL: ENSMUSP00000004968 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004968]
Predicted Effect probably damaging
Transcript: ENSMUST00000004968
AA Change: H616L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000004968
Gene: ENSMUSG00000004846
AA Change: H616L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 312 324 N/A INTRINSIC
Blast:P4Hc 456 502 2e-8 BLAST
P4Hc 567 740 1.43e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102285
Predicted Effect unknown
Transcript: ENSMUST00000127100
AA Change: H86L
SMART Domains Protein: ENSMUSP00000123550
Gene: ENSMUSG00000004846
AA Change: H86L

DomainStartEndE-ValueType
Blast:P4Hc 2 35 2e-11 BLAST
P4Hc 38 200 3.04e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129896
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131667
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137419
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144784
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151642
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane-bound homodimeric enzyme that is localized to the cisternae of the rough endoplasmic reticulum. The enzyme (cofactors iron and ascorbate) catalyzes the hydroxylation of lysyl residues in collagen-like peptides. The resultant hydroxylysyl groups are attachment sites for carbohydrates in collagen and thus are critical for the stability of intermolecular crosslinks. Some patients with Ehlers-Danlos syndrome type VIB have deficiencies in lysyl hydroxylase activity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality, reduced embryonic growth, fragility, and fragmented basement membranes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik A G 10: 29,224,809 K393E possibly damaging Het
Acsm4 A T 7: 119,703,365 M238L possibly damaging Het
Adam2 G A 14: 66,057,610 S262L probably damaging Het
Atp13a5 T A 16: 29,298,194 I579L probably benign Het
Canx A G 11: 50,308,383 V153A probably damaging Het
Cdan1 A G 2: 120,725,632 Y718H probably damaging Het
Cdan1 G A 2: 120,731,020 probably benign Het
Cpsf3 A G 12: 21,313,805 D632G probably benign Het
Dach1 T C 14: 97,840,109 T561A probably damaging Het
Dennd5a A G 7: 109,905,699 M868T probably benign Het
Dhx29 C T 13: 112,930,921 A112V probably benign Het
Fanca G A 8: 123,316,363 R95C probably benign Het
Fat4 C A 3: 38,982,346 N3382K probably benign Het
Fkbp15 A C 4: 62,334,252 F290L probably benign Het
Fkbp8 T G 8: 70,534,867 S376A probably damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Igfn1 A G 1: 135,967,180 Y1883H possibly damaging Het
Ighv3-4 T A 12: 114,253,680 Q97L probably damaging Het
Igkv15-103 A T 6: 68,437,919 Y114F probably benign Het
Kera G A 10: 97,612,845 R309H probably benign Het
Kif1a T A 1: 93,025,694 H1256L probably damaging Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Lmx1b T C 2: 33,569,094 E149G probably damaging Het
Me2 A G 18: 73,781,132 F443L probably damaging Het
Med12l T A 3: 59,073,168 S307R probably damaging Het
Mocs2 T A 13: 114,825,267 probably null Het
Nek7 C A 1: 138,534,389 C79F probably damaging Het
Olfr1042 A G 2: 86,159,938 V144A probably benign Het
Olfr1173 A G 2: 88,275,004 F15S probably damaging Het
Olfr127 A T 17: 37,903,609 H21L probably benign Het
Olfr566 A G 7: 102,856,617 C222R probably damaging Het
Ovch2 G A 7: 107,789,111 L421F probably damaging Het
Pan2 C T 10: 128,315,177 R806C probably damaging Het
Plxnb3 T C X: 73,771,220 V1789A probably benign Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Rrnad1 T C 3: 87,926,828 K116R possibly damaging Het
Tbc1d9 C T 8: 83,233,532 T138I probably damaging Het
Tdrkh A G 3: 94,428,249 N383S probably damaging Het
Trim30d C T 7: 104,472,521 G339D probably damaging Het
Trub1 G A 19: 57,485,366 A239T possibly damaging Het
Tspan32 T A 7: 143,006,998 M61K probably damaging Het
Ttc6 T C 12: 57,697,452 V1290A probably benign Het
Ttn A G 2: 76,969,249 V429A possibly damaging Het
Unc13b A G 4: 43,256,834 Y3962C probably damaging Het
Usp3 T C 9: 66,562,591 T83A probably benign Het
Vmn2r95 T A 17: 18,440,096 Y257N possibly damaging Het
Zmym6 T C 4: 127,123,296 S957P possibly damaging Het
Zmynd8 T C 2: 165,812,475 T722A probably damaging Het
Other mutations in Plod3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Plod3 APN 5 136996176 missense possibly damaging 0.78
IGL01090:Plod3 APN 5 136990236 missense probably benign 0.37
IGL01443:Plod3 APN 5 136990221 missense probably benign 0.17
IGL01583:Plod3 APN 5 136996148 missense probably benign 0.02
R0544:Plod3 UTSW 5 136991611 missense probably benign 0.09
R0747:Plod3 UTSW 5 136988195 missense probably benign 0.34
R0764:Plod3 UTSW 5 136989583 unclassified probably benign
R1520:Plod3 UTSW 5 136991311 missense probably damaging 0.99
R1631:Plod3 UTSW 5 136988993 missense probably damaging 1.00
R1751:Plod3 UTSW 5 136990176 missense possibly damaging 0.89
R1767:Plod3 UTSW 5 136990176 missense possibly damaging 0.89
R1984:Plod3 UTSW 5 136990853 splice site probably null
R1985:Plod3 UTSW 5 136990853 splice site probably null
R2137:Plod3 UTSW 5 136988717 missense probably damaging 1.00
R2148:Plod3 UTSW 5 136987773 nonsense probably null
R2179:Plod3 UTSW 5 136991008 missense possibly damaging 0.77
R2318:Plod3 UTSW 5 136988146 missense probably benign 0.38
R2319:Plod3 UTSW 5 136988146 missense probably benign 0.38
R2512:Plod3 UTSW 5 136988146 missense probably benign 0.38
R2513:Plod3 UTSW 5 136988146 missense probably benign 0.38
R2696:Plod3 UTSW 5 136988146 missense probably benign 0.38
R2891:Plod3 UTSW 5 136988146 missense probably benign 0.38
R2893:Plod3 UTSW 5 136988146 missense probably benign 0.38
R3030:Plod3 UTSW 5 136988146 missense probably benign 0.38
R3439:Plod3 UTSW 5 136988146 missense probably benign 0.38
R4080:Plod3 UTSW 5 136988146 missense probably benign 0.38
R4081:Plod3 UTSW 5 136988146 missense probably benign 0.38
R4342:Plod3 UTSW 5 136988146 missense probably benign 0.38
R4344:Plod3 UTSW 5 136988146 missense probably benign 0.38
R4345:Plod3 UTSW 5 136988146 missense probably benign 0.38
R4546:Plod3 UTSW 5 136988947 missense possibly damaging 0.94
R4799:Plod3 UTSW 5 136990800 missense probably benign 0.00
R4843:Plod3 UTSW 5 136991000 nonsense probably null
R4956:Plod3 UTSW 5 136989918 missense probably damaging 1.00
R5159:Plod3 UTSW 5 136995078 intron probably benign
R5162:Plod3 UTSW 5 136991307 missense probably damaging 1.00
R5328:Plod3 UTSW 5 136989683 missense probably damaging 1.00
R5427:Plod3 UTSW 5 136991788 missense probably damaging 1.00
R6627:Plod3 UTSW 5 136988456 missense probably damaging 0.99
R7003:Plod3 UTSW 5 136989644 missense probably damaging 1.00
R7132:Plod3 UTSW 5 136995117 missense
R7376:Plod3 UTSW 5 136990481 missense probably benign 0.00
R7404:Plod3 UTSW 5 136995047 missense probably benign
R7827:Plod3 UTSW 5 136989981 missense probably benign
R8062:Plod3 UTSW 5 136990269 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TGCTTCTAGATGTCACAGACAG -3'
(R):5'- TCAGTTGCTAAAGGGCTGAG -3'

Sequencing Primer
(F):5'- GGTGAATCTCTAAGTTCAAGCCCAG -3'
(R):5'- AGGGCGGGGTCCACATAG -3'
Posted On2015-04-29