Mutagenetix > Incidental Mutations

Incidental Mutation 'R4345:Plod3'

324293

Institutional Source

Beutler Lab

Gene Symbol

Plod3

Ensembl Gene

ENSMUSG00000004846

Gene Name

procollagen-lysine, 2-oxoglutarate 5-dioxygenase 3

Synonyms

lysyl hydroxylase 3, LH3

MMRRC Submission

041666-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4345 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

136987019-136996648 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to C at 136988146 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Proline at position 50 (A50P)

Ref Sequence

ENSEMBL: ENSMUSP00000004968 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004968] [ENSMUST00000034953] [ENSMUST00000085941] [ENSMUST00000111090] [ENSMUST00000111091] [ENSMUST00000137272] [ENSMUST00000156963]

Predicted Effect

probably benign
Transcript: ENSMUST00000004968
AA Change: A50P

PolyPhen 2 Score 0.382 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000004968
Gene: ENSMUSG00000004846
AA Change: A50P

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
low complexity region	312	324	N/A	INTRINSIC
Blast:P4Hc	456	502	2e-8	BLAST
P4Hc	567	740	1.43e-23	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000034953

SMART Domains

Protein: ENSMUSP00000034953
Gene: ENSMUSG00000059518

Domain	Start	End	E-Value	Type
low complexity region	14	26	N/A	INTRINSIC
low complexity region	58	73	N/A	INTRINSIC
Pfam:zf-HIT	112	141	6.3e-13	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000085941

SMART Domains

Protein: ENSMUSP00000083103
Gene: ENSMUSG00000059518

Domain	Start	End	E-Value	Type
low complexity region	15	27	N/A	INTRINSIC
low complexity region	59	74	N/A	INTRINSIC
Pfam:zf-HIT	113	142	3e-13	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000102285

Predicted Effect

probably benign
Transcript: ENSMUST00000111090

SMART Domains

Protein: ENSMUSP00000106719
Gene: ENSMUSG00000059518

Domain	Start	End	E-Value	Type
low complexity region	14	26	N/A	INTRINSIC
low complexity region	58	73	N/A	INTRINSIC
Pfam:zf-HIT	112	141	2.2e-14	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000111091

SMART Domains

Protein: ENSMUSP00000106720
Gene: ENSMUSG00000059518

Domain	Start	End	E-Value	Type
low complexity region	19	31	N/A	INTRINSIC
low complexity region	63	78	N/A	INTRINSIC
Pfam:zf-HIT	117	146	2.1e-13	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000127100

SMART Domains

Protein: ENSMUSP00000123550
Gene: ENSMUSG00000004846

Domain	Start	End	E-Value	Type
Blast:P4Hc	2	35	2e-11	BLAST
P4Hc	38	200	3.04e-4	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129896

Predicted Effect

probably benign
Transcript: ENSMUST00000137272

SMART Domains

Protein: ENSMUSP00000120331
Gene: ENSMUSG00000059518

Domain	Start	End	E-Value	Type
low complexity region	19	31	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137419

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144784

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151642

Predicted Effect

probably benign
Transcript: ENSMUST00000156963

SMART Domains

Protein: ENSMUSP00000115929
Gene: ENSMUSG00000059518

Domain	Start	End	E-Value	Type
low complexity region	14	26	N/A	INTRINSIC
low complexity region	58	73	N/A	INTRINSIC
Pfam:zf-HIT	112	141	6.7e-13	PFAM

Meta Mutation Damage Score

0.1039

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.6%
20x: 95.9%

Validation Efficiency

96% (47/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane-bound homodimeric enzyme that is localized to the cisternae of the rough endoplasmic reticulum. The enzyme (cofactors iron and ascorbate) catalyzes the hydroxylation of lysyl residues in collagen-like peptides. The resultant hydroxylysyl groups are attachment sites for carbohydrates in collagen and thus are critical for the stability of intermolecular crosslinks. Some patients with Ehlers-Danlos syndrome type VIB have deficiencies in lysyl hydroxylase activity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality, reduced embryonic growth, fragility, and fragmented basement membranes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Asap2	T	C	12: 21,230,831	W449R	probably damaging	Het
Astn1	T	A	1: 158,502,032		probably null	Het
BC005561	A	G	5: 104,521,449	E1279G	probably benign	Het
C3ar1	T	C	6: 122,850,700	D186G	probably damaging	Het
Fbf1	A	G	11: 116,147,742	V851A	probably benign	Het
Foxp4	G	A	17: 47,874,648	T500M	unknown	Het
Gm5878	G	A	6: 85,125,651	R31*	probably null	Het
Gramd4	T	C	15: 86,134,893	S581P	probably damaging	Het
Heatr5b	A	T	17: 78,760,511	V1816E	possibly damaging	Het
Igf2r	C	T	17: 12,709,511	E982K	possibly damaging	Het
Il1r1	A	G	1: 40,297,924	D224G	probably benign	Het
Kcnv1	G	A	15: 45,114,444	T66M	probably damaging	Het
Lactb2	T	A	1: 13,660,350	Y34F	probably damaging	Het
Lepr	G	A	4: 101,765,152		probably null	Het
Loxhd1	A	G	18: 77,399,001	I1261V	possibly damaging	Het
Map4k3	A	G	17: 80,597,551		probably null	Het
Mcee	T	C	7: 64,411,938	L109P	probably damaging	Het
Mier3	A	G	13: 111,705,283	D124G	probably damaging	Het
Mrpl43	T	C	19: 45,006,110	Y64C	probably damaging	Het
Nfasc	A	G	1: 132,631,705	F229S	probably damaging	Het
Nsd3	G	C	8: 25,641,317	G233R	probably benign	Het
Olfr1065	T	A	2: 86,445,845	I46F	probably damaging	Het
Olfr320	A	G	11: 58,683,945	D24G	possibly damaging	Het
Pdzd8	T	C	19: 59,300,128	T947A	probably benign	Het
Pno1	A	G	11: 17,209,095	S158P	possibly damaging	Het
Prr14l	A	G	5: 32,828,576	S1192P	probably damaging	Het
Setbp1	T	A	18: 79,086,579	E146V	probably damaging	Het
Slc9a5	T	C	8: 105,349,455	S27P	probably benign	Het
Sri	G	T	5: 8,059,427		probably null	Het
Stard9	G	A	2: 120,701,946	V2895I	probably benign	Het
Tgfbrap1	T	C	1: 43,056,706	D524G	probably benign	Het
Them4	A	G	3: 94,329,865	T211A	possibly damaging	Het
Trpm3	A	T	19: 22,897,697	S568C	probably damaging	Het
Ttl	T	C	2: 129,075,858	L80P	probably damaging	Het
Ttn	G	T	2: 76,756,316	N13423K	possibly damaging	Het
Usp10	T	A	8: 119,954,814	L670Q	probably damaging	Het
Usp4	T	A	9: 108,368,023		probably benign	Het
Vmn1r72	T	A	7: 11,670,036	T162S	possibly damaging	Het
Zmym5	T	C	14: 56,796,626	N376S	probably benign	Het
Zswim6	G	T	13: 107,726,931		noncoding transcript	Het

Other mutations in Plod3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00507:Plod3	APN	5	136996176	missense	possibly damaging	0.78
IGL01090:Plod3	APN	5	136990236	missense	probably benign	0.37
IGL01443:Plod3	APN	5	136990221	missense	probably benign	0.17
IGL01583:Plod3	APN	5	136996148	missense	probably benign	0.02
R0544:Plod3	UTSW	5	136991611	missense	probably benign	0.09
R0747:Plod3	UTSW	5	136988195	missense	probably benign	0.34
R0764:Plod3	UTSW	5	136989583	unclassified	probably benign
R1520:Plod3	UTSW	5	136991311	missense	probably damaging	0.99
R1631:Plod3	UTSW	5	136988993	missense	probably damaging	1.00
R1751:Plod3	UTSW	5	136990176	missense	possibly damaging	0.89
R1767:Plod3	UTSW	5	136990176	missense	possibly damaging	0.89
R1984:Plod3	UTSW	5	136990853	splice site	probably null
R1985:Plod3	UTSW	5	136990853	splice site	probably null
R2137:Plod3	UTSW	5	136988717	missense	probably damaging	1.00
R2148:Plod3	UTSW	5	136987773	nonsense	probably null
R2179:Plod3	UTSW	5	136991008	missense	possibly damaging	0.77
R2318:Plod3	UTSW	5	136988146	missense	probably benign	0.38
R2319:Plod3	UTSW	5	136988146	missense	probably benign	0.38
R2512:Plod3	UTSW	5	136988146	missense	probably benign	0.38
R2513:Plod3	UTSW	5	136988146	missense	probably benign	0.38
R2696:Plod3	UTSW	5	136988146	missense	probably benign	0.38
R2891:Plod3	UTSW	5	136988146	missense	probably benign	0.38
R2893:Plod3	UTSW	5	136988146	missense	probably benign	0.38
R3030:Plod3	UTSW	5	136988146	missense	probably benign	0.38
R3439:Plod3	UTSW	5	136988146	missense	probably benign	0.38
R3957:Plod3	UTSW	5	136994192	missense	probably damaging	1.00
R4080:Plod3	UTSW	5	136988146	missense	probably benign	0.38
R4081:Plod3	UTSW	5	136988146	missense	probably benign	0.38
R4342:Plod3	UTSW	5	136988146	missense	probably benign	0.38
R4344:Plod3	UTSW	5	136988146	missense	probably benign	0.38
R4546:Plod3	UTSW	5	136988947	missense	possibly damaging	0.94
R4799:Plod3	UTSW	5	136990800	missense	probably benign	0.00
R4843:Plod3	UTSW	5	136991000	nonsense	probably null
R4956:Plod3	UTSW	5	136989918	missense	probably damaging	1.00
R5159:Plod3	UTSW	5	136995078	intron	probably benign
R5162:Plod3	UTSW	5	136991307	missense	probably damaging	1.00
R5328:Plod3	UTSW	5	136989683	missense	probably damaging	1.00
R5427:Plod3	UTSW	5	136991788	missense	probably damaging	1.00
R6627:Plod3	UTSW	5	136988456	missense	probably damaging	0.99
R7003:Plod3	UTSW	5	136989644	missense	probably damaging	1.00
R7132:Plod3	UTSW	5	136995117	missense
R7376:Plod3	UTSW	5	136990481	missense	probably benign	0.00
R7404:Plod3	UTSW	5	136995047	missense	probably benign
R7827:Plod3	UTSW	5	136989981	missense	probably benign
R8062:Plod3	UTSW	5	136990269	missense	possibly damaging	0.87
R8506:Plod3	UTSW	5	136988976	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTCTTCTGGAGATCAAATGTGCTG -3'
(R):5'- ACTGTTCGAGCCACATCACC -3'

Sequencing Primer
(F):5'- TGTGCTGAAAGAACTTTAGTGAAG -3'
(R):5'- CCCAGGGTCTGCAGGAAAGATC -3'

Posted On

2015-06-24