Incidental Mutation 'R4956:Plod3'
ID381572
Institutional Source Beutler Lab
Gene Symbol Plod3
Ensembl Gene ENSMUSG00000004846
Gene Nameprocollagen-lysine, 2-oxoglutarate 5-dioxygenase 3
Synonymslysyl hydroxylase 3, LH3
MMRRC Submission 042553-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4956 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location136987019-136996648 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 136989918 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 270 (N270D)
Ref Sequence ENSEMBL: ENSMUSP00000004968 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004968] [ENSMUST00000034953] [ENSMUST00000085941] [ENSMUST00000111090] [ENSMUST00000111091] [ENSMUST00000137272] [ENSMUST00000156963]
Predicted Effect probably damaging
Transcript: ENSMUST00000004968
AA Change: N270D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000004968
Gene: ENSMUSG00000004846
AA Change: N270D

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 312 324 N/A INTRINSIC
Blast:P4Hc 456 502 2e-8 BLAST
P4Hc 567 740 1.43e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000034953
SMART Domains Protein: ENSMUSP00000034953
Gene: ENSMUSG00000059518

DomainStartEndE-ValueType
low complexity region 14 26 N/A INTRINSIC
low complexity region 58 73 N/A INTRINSIC
Pfam:zf-HIT 112 141 6.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000085941
SMART Domains Protein: ENSMUSP00000083103
Gene: ENSMUSG00000059518

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
low complexity region 59 74 N/A INTRINSIC
Pfam:zf-HIT 113 142 3e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102285
Predicted Effect probably benign
Transcript: ENSMUST00000111090
SMART Domains Protein: ENSMUSP00000106719
Gene: ENSMUSG00000059518

DomainStartEndE-ValueType
low complexity region 14 26 N/A INTRINSIC
low complexity region 58 73 N/A INTRINSIC
Pfam:zf-HIT 112 141 2.2e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111091
SMART Domains Protein: ENSMUSP00000106720
Gene: ENSMUSG00000059518

DomainStartEndE-ValueType
low complexity region 19 31 N/A INTRINSIC
low complexity region 63 78 N/A INTRINSIC
Pfam:zf-HIT 117 146 2.1e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127100
SMART Domains Protein: ENSMUSP00000123550
Gene: ENSMUSG00000004846

DomainStartEndE-ValueType
Blast:P4Hc 2 35 2e-11 BLAST
P4Hc 38 200 3.04e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129896
Predicted Effect probably benign
Transcript: ENSMUST00000137272
SMART Domains Protein: ENSMUSP00000120331
Gene: ENSMUSG00000059518

DomainStartEndE-ValueType
low complexity region 19 31 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137419
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144784
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151642
Predicted Effect probably benign
Transcript: ENSMUST00000156963
SMART Domains Protein: ENSMUSP00000115929
Gene: ENSMUSG00000059518

DomainStartEndE-ValueType
low complexity region 14 26 N/A INTRINSIC
low complexity region 58 73 N/A INTRINSIC
Pfam:zf-HIT 112 141 6.7e-13 PFAM
Meta Mutation Damage Score 0.9407 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.1%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane-bound homodimeric enzyme that is localized to the cisternae of the rough endoplasmic reticulum. The enzyme (cofactors iron and ascorbate) catalyzes the hydroxylation of lysyl residues in collagen-like peptides. The resultant hydroxylysyl groups are attachment sites for carbohydrates in collagen and thus are critical for the stability of intermolecular crosslinks. Some patients with Ehlers-Danlos syndrome type VIB have deficiencies in lysyl hydroxylase activity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality, reduced embryonic growth, fragility, and fragmented basement membranes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik G C 1: 120,169,110 probably benign Het
3110009E18Rik G T 1: 120,169,119 probably benign Het
3110009E18Rik C T 1: 120,169,120 probably benign Het
4930562C15Rik A G 16: 4,854,952 K866E probably damaging Het
5830411N06Rik A G 7: 140,298,362 I1001V probably benign Het
Afap1l2 T C 19: 56,943,447 M49V probably benign Het
Atf7ip C T 6: 136,606,810 R1280C probably damaging Het
Atp2a2 A G 5: 122,461,580 F583L probably benign Het
Atxn7l3b A G 10: 112,928,596 C43R probably damaging Het
Axin2 T C 11: 108,943,078 V617A probably damaging Het
Brd1 A T 15: 88,730,113 F193Y probably damaging Het
Cdc27 T C 11: 104,529,395 S141G probably damaging Het
Chst9 A T 18: 15,717,988 F7Y probably damaging Het
Cpn2 T A 16: 30,260,415 Q156L possibly damaging Het
Dcaf6 A T 1: 165,388,785 D416E probably benign Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Eif2s3y A G Y: 1,023,407 T430A possibly damaging Het
Enah G A 1: 181,918,289 T401I probably damaging Het
Esp38 T G 17: 39,955,162 I54R probably damaging Het
Ffar4 C T 19: 38,097,580 R152W probably benign Het
Fzd9 G A 5: 135,249,942 A363V probably damaging Het
Gadl1 T A 9: 116,040,919 I451N probably benign Het
Hmg20a A G 9: 56,481,664 T172A probably damaging Het
Ints1 G A 5: 139,757,130 T1695M probably damaging Het
Ipo13 G A 4: 117,901,571 A699V probably benign Het
Ipo9 A G 1: 135,404,222 probably null Het
Klra17 A G 6: 129,873,316 L57P probably damaging Het
Map3k8 A C 18: 4,339,530 D280E probably benign Het
Mfsd7b A G 1: 191,026,186 probably benign Het
Mycbp2 A G 14: 103,287,239 F662L probably damaging Het
Ncor1 T A 11: 62,340,605 H792L probably damaging Het
Nlrx1 T A 9: 44,262,612 K431* probably null Het
Nos1 A G 5: 117,947,510 N1301S probably benign Het
Obp2b A G 2: 25,737,075 T7A probably damaging Het
Odc1 T C 12: 17,547,957 I95T probably damaging Het
Olfr1262 G A 2: 90,002,843 V146M probably benign Het
Olfr1447 C T 19: 12,901,599 M60I probably damaging Het
Olfr224 A G 11: 58,566,518 Y276H probably damaging Het
Olfr522 A G 7: 140,162,080 I290T possibly damaging Het
Olfr802 A T 10: 129,682,099 F213L probably benign Het
Pcif1 A T 2: 164,889,690 Q521L probably damaging Het
Plekhg2 A C 7: 28,368,355 L223R probably damaging Het
Ppp1r37 A T 7: 19,532,711 L417* probably null Het
Psmd6 C T 14: 14,116,166 V141I probably benign Het
Rcn1 A T 2: 105,394,776 Y111* probably null Het
Rell2 G A 18: 37,957,705 R145H probably damaging Het
Scaper T C 9: 55,838,142 K614R probably damaging Het
Shbg C T 11: 69,617,219 E107K probably damaging Het
Slc30a3 G A 5: 31,086,903 P345L possibly damaging Het
Tchp A C 5: 114,719,620 E391D probably damaging Het
Timeless A G 10: 128,241,651 D200G probably damaging Het
Tspear A G 10: 77,864,767 T144A possibly damaging Het
Uhrf1bp1 T A 17: 27,889,984 probably null Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Vgll3 T C 16: 65,827,934 V56A possibly damaging Het
Vmn2r71 C T 7: 85,619,228 T213I probably benign Het
Wtap T C 17: 12,967,536 T375A probably benign Het
Yipf2 T G 9: 21,591,908 T88P probably damaging Het
Zfp382 T A 7: 30,131,554 D89E probably benign Het
Zfp955b C T 17: 33,305,235 probably benign Het
Zpr1 C T 9: 46,274,663 T144I probably damaging Het
Other mutations in Plod3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Plod3 APN 5 136996176 missense possibly damaging 0.78
IGL01090:Plod3 APN 5 136990236 missense probably benign 0.37
IGL01443:Plod3 APN 5 136990221 missense probably benign 0.17
IGL01583:Plod3 APN 5 136996148 missense probably benign 0.02
R0544:Plod3 UTSW 5 136991611 missense probably benign 0.09
R0747:Plod3 UTSW 5 136988195 missense probably benign 0.34
R0764:Plod3 UTSW 5 136989583 unclassified probably benign
R1520:Plod3 UTSW 5 136991311 missense probably damaging 0.99
R1631:Plod3 UTSW 5 136988993 missense probably damaging 1.00
R1751:Plod3 UTSW 5 136990176 missense possibly damaging 0.89
R1767:Plod3 UTSW 5 136990176 missense possibly damaging 0.89
R1984:Plod3 UTSW 5 136990853 splice site probably null
R1985:Plod3 UTSW 5 136990853 splice site probably null
R2137:Plod3 UTSW 5 136988717 missense probably damaging 1.00
R2148:Plod3 UTSW 5 136987773 nonsense probably null
R2179:Plod3 UTSW 5 136991008 missense possibly damaging 0.77
R2318:Plod3 UTSW 5 136988146 missense probably benign 0.38
R2319:Plod3 UTSW 5 136988146 missense probably benign 0.38
R2512:Plod3 UTSW 5 136988146 missense probably benign 0.38
R2513:Plod3 UTSW 5 136988146 missense probably benign 0.38
R2696:Plod3 UTSW 5 136988146 missense probably benign 0.38
R2891:Plod3 UTSW 5 136988146 missense probably benign 0.38
R2893:Plod3 UTSW 5 136988146 missense probably benign 0.38
R3030:Plod3 UTSW 5 136988146 missense probably benign 0.38
R3439:Plod3 UTSW 5 136988146 missense probably benign 0.38
R3957:Plod3 UTSW 5 136994192 missense probably damaging 1.00
R4080:Plod3 UTSW 5 136988146 missense probably benign 0.38
R4081:Plod3 UTSW 5 136988146 missense probably benign 0.38
R4342:Plod3 UTSW 5 136988146 missense probably benign 0.38
R4344:Plod3 UTSW 5 136988146 missense probably benign 0.38
R4345:Plod3 UTSW 5 136988146 missense probably benign 0.38
R4546:Plod3 UTSW 5 136988947 missense possibly damaging 0.94
R4799:Plod3 UTSW 5 136990800 missense probably benign 0.00
R4843:Plod3 UTSW 5 136991000 nonsense probably null
R5159:Plod3 UTSW 5 136995078 intron probably benign
R5162:Plod3 UTSW 5 136991307 missense probably damaging 1.00
R5328:Plod3 UTSW 5 136989683 missense probably damaging 1.00
R5427:Plod3 UTSW 5 136991788 missense probably damaging 1.00
R6627:Plod3 UTSW 5 136988456 missense probably damaging 0.99
R7003:Plod3 UTSW 5 136989644 missense probably damaging 1.00
R7132:Plod3 UTSW 5 136995117 missense
R7376:Plod3 UTSW 5 136990481 missense probably benign 0.00
R7404:Plod3 UTSW 5 136995047 missense probably benign
R7827:Plod3 UTSW 5 136989981 missense probably benign
R8062:Plod3 UTSW 5 136990269 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- AATGGTCCCACTAAGGTGCC -3'
(R):5'- TAGGCTGCTCCACAAACACG -3'

Sequencing Primer
(F):5'- ACTAAGGTGCCCCCATGC -3'
(R):5'- AAGCCCAGACCTCTCTCTG -3'
Posted On2016-04-27