Incidental Mutation 'R4124:4933409G03Rik'
ID315306
Institutional Source Beutler Lab
Gene Symbol 4933409G03Rik
Ensembl Gene ENSMUSG00000053896
Gene NameRIKEN cDNA 4933409G03 gene
Synonyms
MMRRC Submission 041632-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R4124 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location68582413-68616463 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 68616224 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000102713]
Predicted Effect unknown
Transcript: ENSMUST00000102713
AA Change: S282R
SMART Domains Protein: ENSMUSP00000099774
Gene: ENSMUSG00000053896
AA Change: S282R

DomainStartEndE-ValueType
low complexity region 74 86 N/A INTRINSIC
low complexity region 89 133 N/A INTRINSIC
low complexity region 194 206 N/A INTRINSIC
low complexity region 220 231 N/A INTRINSIC
low complexity region 260 272 N/A INTRINSIC
low complexity region 293 305 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137117
SMART Domains Protein: ENSMUSP00000117165
Gene: ENSMUSG00000053896

DomainStartEndE-ValueType
low complexity region 56 68 N/A INTRINSIC
low complexity region 71 115 N/A INTRINSIC
low complexity region 176 188 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik T A 7: 40,993,921 M338K probably damaging Het
Adamtsl4 C T 3: 95,681,672 R483Q probably benign Het
Aldh7a1 A T 18: 56,537,323 probably benign Het
Ank T C 15: 27,571,623 F327S probably damaging Het
Ap2b1 A G 11: 83,365,645 probably null Het
Cd6 G T 19: 10,790,608 P630T probably damaging Het
Cdk19 A G 10: 40,394,395 I67V probably benign Het
D630003M21Rik C T 2: 158,196,593 V978M probably damaging Het
Dsp A G 13: 38,186,713 D864G probably damaging Het
Duox1 A G 2: 122,337,421 R1062G probably damaging Het
Fbp2 T C 13: 62,854,941 E99G probably damaging Het
Fras1 A G 5: 96,770,653 D3516G probably benign Het
Gpx6 C T 13: 21,317,645 Q146* probably null Het
Grid2 A T 6: 63,503,433 Q77L probably benign Het
Hrh1 T C 6: 114,480,619 V287A probably benign Het
Kmt2a T C 9: 44,819,796 probably benign Het
Mak A T 13: 41,056,630 D43E probably benign Het
Olfr761 A G 17: 37,952,790 I78T probably benign Het
Poln A G 5: 34,103,951 S561P probably benign Het
Ptpn11 T C 5: 121,137,457 S562G probably benign Het
Pxn A G 5: 115,546,907 R264G probably damaging Het
Rell2 A G 18: 37,958,214 H144R probably benign Het
Rpgrip1 T C 14: 52,152,324 probably null Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slamf9 T C 1: 172,476,241 I51T probably damaging Het
Tep1 C T 14: 50,843,734 R1349Q possibly damaging Het
Tgtp2 T C 11: 49,059,411 I111M probably damaging Het
Trip11 G A 12: 101,895,698 Q203* probably null Het
Vmn1r215 A T 13: 23,075,993 T68S probably benign Het
Ypel2 A G 11: 86,945,927 probably null Het
Other mutations in 4933409G03Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:4933409G03Rik APN 2 68601898 missense unknown
IGL00514:4933409G03Rik APN 2 68601797 missense unknown
IGL02173:4933409G03Rik APN 2 68613057 missense unknown
IGL02252:4933409G03Rik APN 2 68614334 splice site probably benign
PIT4812001:4933409G03Rik UTSW 2 68588948 missense probably benign 0.16
R0196:4933409G03Rik UTSW 2 68616247 unclassified probably benign
R1939:4933409G03Rik UTSW 2 68588984 missense possibly damaging 0.83
R2422:4933409G03Rik UTSW 2 68591520 missense probably benign 0.16
R3435:4933409G03Rik UTSW 2 68601845 missense unknown
R4243:4933409G03Rik UTSW 2 68593543 intron probably benign
R4424:4933409G03Rik UTSW 2 68615147 unclassified probably benign
R4649:4933409G03Rik UTSW 2 68606215 missense unknown
R4650:4933409G03Rik UTSW 2 68606215 missense unknown
R4651:4933409G03Rik UTSW 2 68606215 missense unknown
R4652:4933409G03Rik UTSW 2 68606215 missense unknown
R4653:4933409G03Rik UTSW 2 68606215 missense unknown
R4732:4933409G03Rik UTSW 2 68614721 unclassified probably benign
R4733:4933409G03Rik UTSW 2 68614721 unclassified probably benign
R5144:4933409G03Rik UTSW 2 68616260 unclassified probably benign
R5499:4933409G03Rik UTSW 2 68601793 missense unknown
R5828:4933409G03Rik UTSW 2 68601800 missense unknown
R5936:4933409G03Rik UTSW 2 68615504 unclassified probably benign
R6323:4933409G03Rik UTSW 2 68606224 missense unknown
R7491:4933409G03Rik UTSW 2 68614755 splice site probably null
Predicted Primers PCR Primer
(F):5'- ACAGGATTGTGCCTATAACTTGA -3'
(R):5'- ATATTTAAAAGAAGTGATGCTGGGAA -3'

Sequencing Primer
(F):5'- GGATTGTGCCTATAACTTGAAAGAC -3'
(R):5'- GGGAACATGCACACTGT -3'
Posted On2015-05-14