Incidental Mutation 'R4184:Mbd2'
ID319896
Institutional Source Beutler Lab
Gene Symbol Mbd2
Ensembl Gene ENSMUSG00000024513
Gene Namemethyl-CpG binding domain protein 2
SynonymsMBD2a
MMRRC Submission 041020-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4184 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location70568189-70626131 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 70617979 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 362 (C362S)
Ref Sequence ENSEMBL: ENSMUSP00000073701 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074058] [ENSMUST00000127260]
Predicted Effect probably damaging
Transcript: ENSMUST00000074058
AA Change: C362S

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000073701
Gene: ENSMUSG00000024513
AA Change: C362S

DomainStartEndE-ValueType
low complexity region 15 31 N/A INTRINSIC
low complexity region 48 128 N/A INTRINSIC
low complexity region 133 145 N/A INTRINSIC
MBD 150 223 1.65e-29 SMART
Pfam:MBDa 226 295 1.3e-32 PFAM
Pfam:MBD_C 299 390 7.9e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127260
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128555
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133889
Meta Mutation Damage Score 0.6524 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 95% (55/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DNA methylation is the major modification of eukaryotic genomes and plays an essential role in mammalian development. Human proteins MECP2, MBD1, MBD2, MBD3, and MBD4 comprise a family of nuclear proteins related by the presence in each of a methyl-CpG binding domain (MBD). Each of these proteins, with the exception of MBD3, is capable of binding specifically to methylated DNA. MECP2, MBD1 and MBD2 can also repress transcription from methylated gene promoters. The protein encoded by this gene may function as a mediator of the biological consequences of the methylation signal. It is also reported that the this protein functions as a demethylase to activate transcription, as DNA methylation causes gene silencing. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for disruption sin this gene are grossly normal. Maternal nurturing problems exist however and they are somewhat resistant to dumor development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ccdc178 A G 18: 22,024,784 L539P probably damaging Het
Cd5 T A 19: 10,721,274 N423I probably damaging Het
Ceacam20 C T 7: 19,976,116 T355I probably damaging Het
Chil4 G A 3: 106,203,727 P284S possibly damaging Het
Cln8 T C 8: 14,895,030 F115L probably benign Het
Cpne9 T A 6: 113,282,457 probably benign Het
Cyp4a32 C T 4: 115,621,523 T484I possibly damaging Het
Des C G 1: 75,362,584 A251G probably benign Het
Dnah3 T C 7: 120,083,293 D270G probably damaging Het
Epc1 T C 18: 6,453,578 E249G possibly damaging Het
Fsbp T A 4: 11,584,058 N252K probably benign Het
Gm498 A T 7: 143,894,121 K234* probably null Het
Gramd1a C A 7: 31,132,515 probably benign Het
Grsf1 G A 5: 88,664,156 P271S probably benign Het
Igsf10 C T 3: 59,319,731 V2174M probably damaging Het
Kcnu1 T C 8: 25,862,417 L204P probably damaging Het
Kdm7a T C 6: 39,148,977 E628G probably benign Het
Klhl36 T C 8: 119,874,385 M381T probably damaging Het
Kpna3 A T 14: 61,368,175 Y474N probably damaging Het
Lsm8 G T 6: 18,849,605 probably benign Het
Mapk8 T C 14: 33,382,220 D413G probably damaging Het
Mex3b A G 7: 82,870,030 R518G probably benign Het
Mical1 T C 10: 41,481,870 probably benign Het
Myo18a T C 11: 77,857,787 S1996P probably damaging Het
Olfr740 A G 14: 50,453,370 Y106C probably damaging Het
Olfr747 C G 14: 50,681,050 E195Q probably benign Het
Olfr97 T G 17: 37,231,848 H174P possibly damaging Het
Otop2 T A 11: 115,329,845 C504S probably benign Het
Pkhd1 T A 1: 20,209,277 H2939L probably benign Het
Pkhd1 C T 1: 20,563,686 V542M probably benign Het
Pkhd1l1 C T 15: 44,591,906 T4021I probably benign Het
Prr36 T C 8: 4,213,409 probably benign Het
Ptchd4 A T 17: 42,502,759 Y517F probably damaging Het
Pth1r A G 9: 110,742,232 M1T probably null Het
Rdx C A 9: 52,067,380 L163M probably damaging Het
Reep6 A G 10: 80,333,814 Y112C probably damaging Het
Rpp21 A G 17: 36,257,719 probably benign Het
Sacs T A 14: 61,213,944 C4480S probably damaging Het
Slc15a1 G A 14: 121,466,162 T512I probably benign Het
Slc22a22 A T 15: 57,256,566 C170* probably null Het
Slc26a2 C T 18: 61,198,832 R509K probably benign Het
Slc4a10 A G 2: 62,317,442 probably benign Het
Stc1 A T 14: 69,029,385 probably benign Het
Tbc1d32 T A 10: 56,224,580 T101S probably benign Het
Tsc2 T C 17: 24,632,016 T23A probably benign Het
Vmn1r52 T G 6: 90,179,237 F174L probably benign Het
Zfp972 G A 2: 177,921,457 Q56* probably null Het
Zfp982 A G 4: 147,512,693 K169R probably benign Het
Zfpl1 A G 19: 6,081,140 L274P probably damaging Het
Other mutations in Mbd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02199:Mbd2 APN 18 70593300 missense probably damaging 1.00
BB007:Mbd2 UTSW 18 70568877 missense probably damaging 0.99
BB017:Mbd2 UTSW 18 70568877 missense probably damaging 0.99
R1596:Mbd2 UTSW 18 70616632 missense probably damaging 0.98
R1769:Mbd2 UTSW 18 70616619 missense probably benign 0.02
R3915:Mbd2 UTSW 18 70622609 missense probably benign 0.02
R4854:Mbd2 UTSW 18 70568735 missense unknown
R6056:Mbd2 UTSW 18 70580803 missense possibly damaging 0.91
R6722:Mbd2 UTSW 18 70580748 missense probably damaging 0.99
R7930:Mbd2 UTSW 18 70568877 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTCAGGAGTAGTTTCCTCTTACC -3'
(R):5'- ACTTACGGTGTCGGATCAGAC -3'

Sequencing Primer
(F):5'- GGAGTAGTTTCCTCTTACCAGCATTG -3'
(R):5'- TGAGCCTAAGGGCTTTCA -3'
Posted On2015-06-10