Incidental Mutation 'R4184:Vmn1r52'
ID319861
Institutional Source Beutler Lab
Gene Symbol Vmn1r52
Ensembl Gene ENSMUSG00000060816
Gene Namevomeronasal 1 receptor 52
SynonymsV1ra7, VN3
MMRRC Submission 041020-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R4184 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location90174808-90181248 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 90179237 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 174 (F174L)
Ref Sequence ENSEMBL: ENSMUSP00000154275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079832] [ENSMUST00000226520] [ENSMUST00000227100] [ENSMUST00000227578] [ENSMUST00000227893] [ENSMUST00000228385] [ENSMUST00000228394] [ENSMUST00000228665]
Predicted Effect probably benign
Transcript: ENSMUST00000079832
AA Change: F174L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000078760
Gene: ENSMUSG00000060816
AA Change: F174L

DomainStartEndE-ValueType
Pfam:V1R 38 302 1e-93 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204789
Predicted Effect probably benign
Transcript: ENSMUST00000226520
AA Change: F174L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000227100
Predicted Effect probably benign
Transcript: ENSMUST00000227578
Predicted Effect probably benign
Transcript: ENSMUST00000227893
AA Change: F174L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000228385
Predicted Effect probably benign
Transcript: ENSMUST00000228394
AA Change: F174L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000228665
AA Change: F174L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 95% (55/58)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ccdc178 A G 18: 22,024,784 L539P probably damaging Het
Cd5 T A 19: 10,721,274 N423I probably damaging Het
Ceacam20 C T 7: 19,976,116 T355I probably damaging Het
Chil4 G A 3: 106,203,727 P284S possibly damaging Het
Cln8 T C 8: 14,895,030 F115L probably benign Het
Cpne9 T A 6: 113,282,457 probably benign Het
Cyp4a32 C T 4: 115,621,523 T484I possibly damaging Het
Des C G 1: 75,362,584 A251G probably benign Het
Dnah3 T C 7: 120,083,293 D270G probably damaging Het
Epc1 T C 18: 6,453,578 E249G possibly damaging Het
Fsbp T A 4: 11,584,058 N252K probably benign Het
Gm498 A T 7: 143,894,121 K234* probably null Het
Gramd1a C A 7: 31,132,515 probably benign Het
Grsf1 G A 5: 88,664,156 P271S probably benign Het
Igsf10 C T 3: 59,319,731 V2174M probably damaging Het
Kcnu1 T C 8: 25,862,417 L204P probably damaging Het
Kdm7a T C 6: 39,148,977 E628G probably benign Het
Klhl36 T C 8: 119,874,385 M381T probably damaging Het
Kpna3 A T 14: 61,368,175 Y474N probably damaging Het
Lsm8 G T 6: 18,849,605 probably benign Het
Mapk8 T C 14: 33,382,220 D413G probably damaging Het
Mbd2 T A 18: 70,617,979 C362S probably damaging Het
Mex3b A G 7: 82,870,030 R518G probably benign Het
Mical1 T C 10: 41,481,870 probably benign Het
Myo18a T C 11: 77,857,787 S1996P probably damaging Het
Olfr740 A G 14: 50,453,370 Y106C probably damaging Het
Olfr747 C G 14: 50,681,050 E195Q probably benign Het
Olfr97 T G 17: 37,231,848 H174P possibly damaging Het
Otop2 T A 11: 115,329,845 C504S probably benign Het
Pkhd1 T A 1: 20,209,277 H2939L probably benign Het
Pkhd1 C T 1: 20,563,686 V542M probably benign Het
Pkhd1l1 C T 15: 44,591,906 T4021I probably benign Het
Prr36 T C 8: 4,213,409 probably benign Het
Ptchd4 A T 17: 42,502,759 Y517F probably damaging Het
Pth1r A G 9: 110,742,232 M1T probably null Het
Rdx C A 9: 52,067,380 L163M probably damaging Het
Reep6 A G 10: 80,333,814 Y112C probably damaging Het
Rpp21 A G 17: 36,257,719 probably benign Het
Sacs T A 14: 61,213,944 C4480S probably damaging Het
Slc15a1 G A 14: 121,466,162 T512I probably benign Het
Slc22a22 A T 15: 57,256,566 C170* probably null Het
Slc26a2 C T 18: 61,198,832 R509K probably benign Het
Slc4a10 A G 2: 62,317,442 probably benign Het
Stc1 A T 14: 69,029,385 probably benign Het
Tbc1d32 T A 10: 56,224,580 T101S probably benign Het
Tsc2 T C 17: 24,632,016 T23A probably benign Het
Zfp972 G A 2: 177,921,457 Q56* probably null Het
Zfp982 A G 4: 147,512,693 K169R probably benign Het
Zfpl1 A G 19: 6,081,140 L274P probably damaging Het
Other mutations in Vmn1r52
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01721:Vmn1r52 APN 6 90178923 missense probably benign
IGL02102:Vmn1r52 APN 6 90179207 missense possibly damaging 0.92
IGL02583:Vmn1r52 APN 6 90179144 nonsense probably null
IGL02938:Vmn1r52 APN 6 90179313 missense possibly damaging 0.58
R0233:Vmn1r52 UTSW 6 90179611 missense possibly damaging 0.96
R0233:Vmn1r52 UTSW 6 90179611 missense possibly damaging 0.96
R0904:Vmn1r52 UTSW 6 90179464 missense probably damaging 0.98
R2190:Vmn1r52 UTSW 6 90179169 missense probably benign 0.12
R4906:Vmn1r52 UTSW 6 90178948 missense possibly damaging 0.63
R5475:Vmn1r52 UTSW 6 90178912 missense probably benign 0.04
R5689:Vmn1r52 UTSW 6 90179250 missense possibly damaging 0.95
R5740:Vmn1r52 UTSW 6 90179194 missense probably benign 0.02
R7263:Vmn1r52 UTSW 6 90179553 missense probably benign 0.00
R7337:Vmn1r52 UTSW 6 90179623 missense probably benign 0.31
R7374:Vmn1r52 UTSW 6 90179136 missense probably benign 0.08
R8161:Vmn1r52 UTSW 6 90179257 missense possibly damaging 0.73
R8699:Vmn1r52 UTSW 6 90178760 missense probably benign 0.02
R8747:Vmn1r52 UTSW 6 90179469 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- AGTGTCTTCCAGGCCATCATC -3'
(R):5'- TTAGAATGGTCCTGAGGGCTC -3'

Sequencing Primer
(F):5'- ATCATCCTCTGCCCTCAAAGC -3'
(R):5'- TCCTGAGGGCTCGTTGC -3'
Posted On2015-06-10