Incidental Mutation 'R4306:Rnf144b'
ID324041
Institutional Source Beutler Lab
Gene Symbol Rnf144b
Ensembl Gene ENSMUSG00000038068
Gene Namering finger protein 144B
SynonymsIbrdc2, E130105P19Rik
MMRRC Submission 041092-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4306 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location47122656-47247991 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 47242942 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 252 (N252D)
Ref Sequence ENSEMBL: ENSMUSP00000105738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068891] [ENSMUST00000110111]
Predicted Effect probably damaging
Transcript: ENSMUST00000068891
AA Change: N252D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071017
Gene: ENSMUSG00000038068
AA Change: N252D

DomainStartEndE-ValueType
RING 30 78 2.24e0 SMART
IBR 101 166 2.16e-16 SMART
IBR 172 238 1.3e0 SMART
RING 191 283 6.17e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110111
AA Change: N252D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105738
Gene: ENSMUSG00000038068
AA Change: N252D

DomainStartEndE-ValueType
RING 30 78 2.24e0 SMART
IBR 101 166 2.16e-16 SMART
IBR 172 238 1.3e0 SMART
RING 191 283 6.17e-2 SMART
Meta Mutation Damage Score 0.2344 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 97% (33/34)
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016D06Rik T A 8: 11,678,590 N27I probably damaging Het
A830018L16Rik C A 1: 11,972,076 S440* probably null Het
Chrdl2 A G 7: 100,022,022 T116A probably damaging Het
Chst12 T C 5: 140,524,646 F343L probably damaging Het
Cpeb2 T A 5: 43,235,235 probably benign Het
Cyp27b1 A G 10: 127,051,088 D391G probably benign Het
Dll3 T C 7: 28,301,657 probably null Het
Dnah7b T A 1: 46,221,772 I2030N probably damaging Het
Fap C T 2: 62,530,707 probably null Het
Frmd4a C T 2: 4,333,078 R32C probably benign Het
Fzd7 T C 1: 59,484,407 V483A probably damaging Het
Gpm6a T C 8: 55,047,393 probably null Het
Gprc6a T C 10: 51,616,639 H539R probably damaging Het
Irs1 C T 1: 82,287,964 A844T probably benign Het
Myo1a T G 10: 127,714,081 S477A probably benign Het
Naga C T 15: 82,336,894 W67* probably null Het
Olfr615 A T 7: 103,561,172 R232* probably null Het
Olfr615 G C 7: 103,561,173 R232T possibly damaging Het
Osbpl1a T C 18: 12,819,595 E87G probably benign Het
Prr27 A G 5: 87,842,907 H126R probably benign Het
Rb1 G A 14: 73,262,695 T504I probably damaging Het
Slit2 T A 5: 48,302,783 N1385K possibly damaging Het
Tas2r124 A G 6: 132,754,991 I88V probably benign Het
Trip11 A G 12: 101,886,939 F465L probably benign Het
Usp31 G A 7: 121,706,929 P109S possibly damaging Het
Vmn2r12 A G 5: 109,086,006 L780P probably damaging Het
Vmn2r71 G T 7: 85,624,152 D725Y probably damaging Het
Zfp459 T C 13: 67,413,188 K47R probably damaging Het
Other mutations in Rnf144b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00814:Rnf144b APN 13 47220488 splice site probably benign
IGL00987:Rnf144b APN 13 47207493 missense possibly damaging 0.57
IGL02712:Rnf144b APN 13 47239779 missense probably damaging 1.00
IGL03002:Rnf144b APN 13 47242883 missense probably damaging 1.00
R0418:Rnf144b UTSW 13 47244490 missense probably benign 0.00
R0464:Rnf144b UTSW 13 47242887 nonsense probably null
R0652:Rnf144b UTSW 13 47220507 missense probably damaging 1.00
R0932:Rnf144b UTSW 13 47220525 missense probably null 0.44
R1472:Rnf144b UTSW 13 47242885 missense probably damaging 1.00
R2341:Rnf144b UTSW 13 47220500 missense probably benign 0.05
R4308:Rnf144b UTSW 13 47242942 missense probably damaging 1.00
R4523:Rnf144b UTSW 13 47207537 missense probably benign 0.08
R5591:Rnf144b UTSW 13 47242954 critical splice donor site probably null
R7323:Rnf144b UTSW 13 47239782 missense probably damaging 1.00
R7887:Rnf144b UTSW 13 47239811 missense probably damaging 1.00
R7970:Rnf144b UTSW 13 47239811 missense probably damaging 1.00
X0064:Rnf144b UTSW 13 47237464 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTGCCCCTGTCAGGATTCCTAG -3'
(R):5'- TGGTCACCCTAACGTTCTGC -3'

Sequencing Primer
(F):5'- TCCTAGAGGAAGTCACTGATAGCATC -3'
(R):5'- AACGTTCTGCTCTCTGGTG -3'
Posted On2015-06-24