Incidental Mutation 'R2913:Hbb-bh1'
ID334564
Institutional Source Beutler Lab
Gene Symbol Hbb-bh1
Ensembl Gene ENSMUSG00000052217
Gene Namehemoglobin Z, beta-like embryonic chain
Synonymsbeta Hl globin, betaH1
MMRRC Submission 040500-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2913 (G1)
Quality Score73
Status Validated
Chromosome7
Chromosomal Location103841637-103843164 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 103843047 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 22 (E22K)
Ref Sequence ENSEMBL: ENSMUSP00000064865 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063957] [ENSMUST00000106866]
Predicted Effect possibly damaging
Transcript: ENSMUST00000063957
AA Change: E22K

PolyPhen 2 Score 0.859 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000064865
Gene: ENSMUSG00000052217
AA Change: E22K

DomainStartEndE-ValueType
Pfam:Globin 8 112 4.2e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106866
SMART Domains Protein: ENSMUSP00000102479
Gene: ENSMUSG00000078621

DomainStartEndE-ValueType
Pfam:Globin 8 112 1.9e-25 PFAM
Meta Mutation Damage Score 0.2801 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The epsilon globin gene (HBE) is normally expressed in the embryonic yolk sac: two epsilon chains together with two zeta chains (an alpha-like globin) constitute the embryonic hemoglobin Hb Gower I; two epsilon chains together with two alpha chains form the embryonic Hb Gower II. Both of these embryonic hemoglobins are normally supplanted by fetal, and later, adult hemoglobin. The five beta-like globin genes are found within a 45 kb cluster on chromosome 11 in the following order: 5'-epsilon - G-gamma - A-gamma - delta - beta-3' [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice with disruptions in this gene are grossly normal and viable through adulthood. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,270,685 S3159P unknown Het
5430419D17Rik T C 7: 131,182,024 S49P possibly damaging Het
9530053A07Rik A T 7: 28,164,307 L2501F probably damaging Het
Acap2 T C 16: 31,116,069 Q357R probably damaging Het
Adap1 C T 5: 139,274,821 probably null Het
Adgrf3 A G 5: 30,196,994 S679P probably damaging Het
Aldh3b1 T C 19: 3,921,275 probably benign Het
Arih2 A G 9: 108,644,076 S68P probably damaging Het
Col1a2 C T 6: 4,519,923 probably benign Het
Crocc C T 4: 141,020,350 R1496H probably damaging Het
Cryl1 T C 14: 57,275,918 E282G probably benign Het
Cyp11b1 T C 15: 74,836,421 T402A probably damaging Het
Etfa C A 9: 55,482,329 A254S probably damaging Het
Fdxacb1 C T 9: 50,768,399 A39V probably benign Het
Fras1 G A 5: 96,733,915 R2502K probably benign Het
Gpr157 G A 4: 150,098,765 V131I probably benign Het
Hmcn2 A G 2: 31,460,210 T5040A possibly damaging Het
Hprt T C X: 53,020,139 Y174H probably damaging Het
Igsf10 T A 3: 59,331,736 L341F possibly damaging Het
Ints1 A G 5: 139,757,913 S1592P possibly damaging Het
Itgam T C 7: 128,112,406 I641T probably damaging Het
Macf1 T A 4: 123,475,911 I121F probably damaging Het
Mapk3 T A 7: 126,760,806 C19* probably null Het
Mapk4 C T 18: 73,935,165 A232T probably benign Het
Med26 T G 8: 72,496,112 K381T possibly damaging Het
Mki67 T C 7: 135,700,686 E873G possibly damaging Het
Mrgpra9 T C 7: 47,235,080 I280V probably benign Het
Mroh9 T C 1: 163,044,003 Y637C probably damaging Het
Nktr T C 9: 121,749,604 probably benign Het
Olfr1052 A G 2: 86,298,389 D191G probably damaging Het
Olfr1206 A T 2: 88,865,114 N170Y probably benign Het
Pam A C 1: 97,923,129 L168R probably damaging Het
Pikfyve G A 1: 65,253,517 V1376M probably damaging Het
Pomt2 A T 12: 87,128,969 N400K probably damaging Het
Pramef12 T C 4: 144,392,734 E421G probably damaging Het
Rbm45 C T 2: 76,375,454 P217S probably benign Het
Rc3h2 A G 2: 37,378,959 S832P possibly damaging Het
Ric3 A G 7: 109,054,453 F144L possibly damaging Het
Rrh G T 3: 129,815,609 A83E probably damaging Het
Rspo2 T A 15: 43,078,114 T138S probably benign Het
Skint5 A G 4: 113,524,092 probably benign Het
Snx29 C T 16: 11,447,453 R516W probably damaging Het
Spata31d1d T C 13: 59,726,955 E922G possibly damaging Het
Spc25 T C 2: 69,199,987 H104R probably benign Het
Sptssa A T 12: 54,656,482 M1K probably null Het
Srrm2 G T 17: 23,815,684 probably benign Het
Tcof1 T C 18: 60,816,084 D1253G possibly damaging Het
Tmem181c-ps A G 17: 6,621,209 noncoding transcript Het
Tmprss15 T C 16: 78,962,190 N880S probably benign Het
Trio T A 15: 27,854,912 Q728L probably damaging Het
Txk T C 5: 72,724,451 N154S probably damaging Het
Vwf T A 6: 125,685,846 V2731E probably benign Het
Yes1 T C 5: 32,640,582 S82P probably benign Het
Zgrf1 T C 3: 127,598,707 V1292A possibly damaging Het
Other mutations in Hbb-bh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01523:Hbb-bh1 APN 7 103841817 missense probably benign 0.03
IGL02229:Hbb-bh1 APN 7 103842825 missense possibly damaging 0.77
IGL02251:Hbb-bh1 APN 7 103842810 nonsense probably null
R5054:Hbb-bh1 UTSW 7 103841856 missense probably benign
R6515:Hbb-bh1 UTSW 7 103842767 missense probably damaging 0.99
R7286:Hbb-bh1 UTSW 7 103843031 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CAGCACTTTCTTGCCATGGG -3'
(R):5'- CCAATAGCCTCAGAGTCCTG -3'

Sequencing Primer
(F):5'- CAGAAGAGAGGTTTCCAAACTTGTC -3'
(R):5'- TCAGAGTCCTGGGGAGGG -3'
Posted On2015-09-02