Mutagenetix > Incidental Mutations

Incidental Mutation 'R4814:Gckr'

369627

Institutional Source

Beutler Lab

Gene Symbol

Gckr

Ensembl Gene

ENSMUSG00000059434

Gene Name

glucokinase regulatory protein

Synonyms

GKRP

MMRRC Submission

042432-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4814 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

31297443-31327314 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 31298300 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 66 (Q66*)

Ref Sequence

ENSEMBL: ENSMUSP00000144568 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041266] [ENSMUST00000072228] [ENSMUST00000172435] [ENSMUST00000201166] [ENSMUST00000201417] [ENSMUST00000201675] [ENSMUST00000202158] [ENSMUST00000202615]

Predicted Effect

probably benign
Transcript: ENSMUST00000041266

SMART Domains

Protein: ENSMUSP00000047185
Gene: ENSMUSG00000038552

Domain	Start	End	E-Value	Type
FN3	43	123	4.35e-11	SMART
transmembrane domain	161	183	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000072228
AA Change: Q66*

SMART Domains

Protein: ENSMUSP00000072084
Gene: ENSMUSG00000059434
AA Change: Q66*

Domain	Start	End	E-Value	Type
PDB:4LC9\|A	1	584	N/A	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000172435

SMART Domains

Protein: ENSMUSP00000127404
Gene: ENSMUSG00000038552

Domain	Start	End	E-Value	Type
FN3	43	123	4.35e-11	SMART
transmembrane domain	161	183	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200845

Predicted Effect

probably null
Transcript: ENSMUST00000201166
AA Change: Q66*

SMART Domains

Protein: ENSMUSP00000144202
Gene: ENSMUSG00000059434
AA Change: Q66*

Domain	Start	End	E-Value	Type
PDB:4LC9\|A	1	620	N/A	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000201417

SMART Domains

Protein: ENSMUSP00000144142
Gene: ENSMUSG00000038552

Domain	Start	End	E-Value	Type
signal peptide	1	40	N/A	INTRINSIC
FN3	43	118	9.4e-8	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000201675
AA Change: Q66*

SMART Domains

Protein: ENSMUSP00000144568
Gene: ENSMUSG00000059434
AA Change: Q66*

Domain	Start	End	E-Value	Type
PDB:4LC9\|A	1	120	7e-64	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201906

Predicted Effect

probably benign
Transcript: ENSMUST00000202158

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202312

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202456

Predicted Effect

probably benign
Transcript: ENSMUST00000202615

SMART Domains

Protein: ENSMUSP00000144195
Gene: ENSMUSG00000038552

Domain	Start	End	E-Value	Type
signal peptide	1	40	N/A	INTRINSIC
FN3	43	123	2.2e-13	SMART
transmembrane domain	161	183	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202909

Meta Mutation Damage Score

0.9753

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.7%
20x: 93.7%

Validation Efficiency

100% (79/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the GCKR subfamily of the SIS (Sugar ISomerase) family of proteins. The gene product is a regulatory protein that inhibits glucokinase in liver and pancreatic islet cells by binding non-covalently to form an inactive complex with the enzyme. This gene is considered a susceptibility gene candidate for a form of maturity-onset diabetes of the young (MODY). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to reduced glucokinase protein levels and activity in the liver and altered glucose homeostasis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abi3bp	T	G	16: 56,650,753	V587G	probably benign	Het
Abtb2	A	G	2: 103,717,287	D1002G	probably benign	Het
Acap2	A	G	16: 31,108,126	S524P	probably benign	Het
Acsm1	A	T	7: 119,655,464	I385L	probably benign	Het
Adra1a	C	G	14: 66,638,032	A152G	probably benign	Het
Agbl4	A	T	4: 111,656,368	Y437F	possibly damaging	Het
Amt	A	G	9: 108,299,780	T196A	probably benign	Het
Apobr	G	A	7: 126,586,687	V457M	probably benign	Het
Birc6	A	G	17: 74,649,672	K3563E	probably damaging	Het
Cdadc1	AGACGGA	AGA	14: 59,568,991		probably null	Het
Chrna9	T	C	5: 65,977,149	W448R	probably damaging	Het
Cyp4a31	A	T	4: 115,570,269	D224V	probably damaging	Het
Ddx10	C	A	9: 53,204,105	R643L	possibly damaging	Het
Dip2c	A	G	13: 9,536,860	H200R	probably benign	Het
Dnah8	A	T	17: 30,767,924	R3182S	probably damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Egfr	T	C	11: 16,869,354	C295R	probably damaging	Het
Garem1	A	T	18: 21,148,116	N394K	probably damaging	Het
Gcat	T	C	15: 79,031,122		probably null	Het
Gm26996	A	T	6: 130,579,354		noncoding transcript	Het
Gm9386	C	A	17: 80,938,712		noncoding transcript	Het
Gpr6	A	T	10: 41,071,262	M108K	possibly damaging	Het
H2-Q10	A	C	17: 35,473,584		probably benign	Het
Hpf1	A	G	8: 60,893,807	D52G	probably damaging	Het
Jak2	A	G	19: 29,301,977	R989G	probably damaging	Het
Kat7	A	G	11: 95,303,123		probably benign	Het
Kcnn3	G	T	3: 89,662,724	V615F	probably damaging	Het
Lgi1	G	T	19: 38,300,878		probably null	Het
Lrrtm4	A	T	6: 80,023,134	T510S	possibly damaging	Het
Map7d1	A	G	4: 126,234,321		probably null	Het
Mapt	T	C	11: 104,298,960	V252A	probably benign	Het
Mbd4	A	T	6: 115,849,299	S223T	possibly damaging	Het
Meig1	T	A	2: 3,411,922	I21L	probably benign	Het
Mia3	A	G	1: 183,332,830	Y447H	probably damaging	Het
Mrpl46	A	C	7: 78,780,595	N142K	probably benign	Het
Myo18a	C	A	11: 77,859,236		probably benign	Het
Nup188	A	G	2: 30,326,511	T776A	possibly damaging	Het
Oas1h	C	A	5: 120,862,665	H113N	probably damaging	Het
Olfr1505	A	T	19: 13,919,453	L144F	possibly damaging	Het
Olfr771	T	A	10: 129,160,376	T203S	possibly damaging	Het
Olfr830	A	G	9: 18,875,917	I197V	probably benign	Het
Olfr845	C	T	9: 19,339,180	T240M	probably damaging	Het
Orc3	T	A	4: 34,572,450		probably benign	Het
Osbpl3	T	A	6: 50,353,000	L65F	probably damaging	Het
Papola	C	A	12: 105,799,653	P4Q	probably damaging	Het
Pepd	A	G	7: 34,945,597	N151S	probably damaging	Het
Plekhm2	A	G	4: 141,627,839	L959P	probably benign	Het
Prpf40a	A	T	2: 53,190,020	H82Q	probably damaging	Het
Robo1	C	T	16: 72,972,035	T496M	probably benign	Het
Samd9l	T	G	6: 3,372,863	Q1466P	probably damaging	Het
Serpina1a	T	C	12: 103,854,763	T342A	probably benign	Het
Serpina3i	A	G	12: 104,265,211	T36A	probably benign	Het
Serpinb5	G	T	1: 106,872,339	L86F	probably damaging	Het
Slc35g1	A	G	19: 38,402,827	S186G	possibly damaging	Het
Slco6d1	T	A	1: 98,423,174	D126E	probably benign	Het
Smchd1	A	G	17: 71,411,768		probably null	Het
Smpdl3a	C	A	10: 57,811,241	T355K	probably damaging	Het
Sntg2	A	G	12: 30,373,268		probably benign	Het
Sox14	T	A	9: 99,875,231	M152L	probably benign	Het
Spats2l	G	T	1: 57,937,926	A308S	possibly damaging	Het
Tcf12	T	C	9: 71,870,041		probably benign	Het
Tcf7l2	T	A	19: 55,924,072	C478*	probably null	Het
Tekt5	A	G	16: 10,382,907	L250P	probably damaging	Het
Tmem132d	T	G	5: 127,984,264	I425L	probably benign	Het
Tmem174	T	A	13: 98,636,948	I125F	probably damaging	Het
Trafd1	T	G	5: 121,374,016	I404L	probably benign	Het
Trpm5	G	A	7: 143,082,636	P500S	possibly damaging	Het
Trpm6	T	A	19: 18,862,212	N1616K	probably benign	Het
Vmn1r4	A	G	6: 56,956,730	D73G	possibly damaging	Het
Vmn2r85	T	A	10: 130,418,698	I706F	probably benign	Het
Zc3h14	C	G	12: 98,752,848	D157E	probably damaging	Het
Zfp982	A	G	4: 147,512,633	Q149R	possibly damaging	Het

Other mutations in Gckr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00164:Gckr	APN	5	31299576	missense	probably damaging	1.00
IGL00325:Gckr	APN	5	31307767	missense	possibly damaging	0.92
IGL00958:Gckr	APN	5	31298785	splice site	probably null
IGL01102:Gckr	APN	5	31309037	missense	probably damaging	0.97
IGL01380:Gckr	APN	5	31299633	unclassified	probably benign
IGL01780:Gckr	APN	5	31307790	missense	possibly damaging	0.82
IGL02110:Gckr	APN	5	31298738	missense	possibly damaging	0.94
IGL02187:Gckr	APN	5	31307424	splice site	probably benign
IGL02350:Gckr	APN	5	31307790	missense	possibly damaging	0.82
IGL02357:Gckr	APN	5	31307790	missense	possibly damaging	0.82
IGL02600:Gckr	APN	5	31305030	missense	probably benign	0.01
IGL02616:Gckr	APN	5	31327075	missense	probably benign	0.07
IGL02803:Gckr	APN	5	31298204	missense	probably damaging	1.00
R0004:Gckr	UTSW	5	31297589	unclassified	probably benign
R0079:Gckr	UTSW	5	31306539	missense	probably benign	0.01
R0165:Gckr	UTSW	5	31326948	missense	possibly damaging	0.90
R0853:Gckr	UTSW	5	31305048	missense	probably damaging	1.00
R0964:Gckr	UTSW	5	31326915	splice site	probably benign
R2174:Gckr	UTSW	5	31327009	missense	possibly damaging	0.95
R2212:Gckr	UTSW	5	31300867	critical splice donor site	probably null
R2892:Gckr	UTSW	5	31326472	missense	probably benign	0.00
R3412:Gckr	UTSW	5	31300867	critical splice donor site	probably null
R3413:Gckr	UTSW	5	31300867	critical splice donor site	probably null
R3764:Gckr	UTSW	5	31326498	splice site	probably benign
R4608:Gckr	UTSW	5	31307797	missense	probably damaging	0.99
R4757:Gckr	UTSW	5	31307384	missense	possibly damaging	0.49
R4953:Gckr	UTSW	5	31308264	missense	probably damaging	1.00
R5906:Gckr	UTSW	5	31306578	missense	probably damaging	1.00
R7030:Gckr	UTSW	5	31302210	missense	possibly damaging	0.89
R7665:Gckr	UTSW	5	31297555
R7684:Gckr	UTSW	5	31307797	missense	probably damaging	1.00
R8432:Gckr	UTSW	5	31309103	missense	possibly damaging	0.82
Z1176:Gckr	UTSW	5	31300831	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GCAGACTTTGGCTTTCTGTC -3'
(R):5'- ACAGTCGCTGTAGAGAGTGG -3'

Sequencing Primer
(F):5'- AGACTTTGGCTTTCTGTCCCTAC -3'
(R):5'- GATCTGAGTTTAATCCCAGGGACC -3'

Posted On

2016-02-04