Incidental Mutation 'R4814:Nup188'
ID369618
Institutional Source Beutler Lab
Gene Symbol Nup188
Ensembl Gene ENSMUSG00000052533
Gene Namenucleoporin 188
Synonyms
MMRRC Submission 042432-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock #R4814 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location30286397-30344266 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30326511 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 776 (T776A)
Ref Sequence ENSEMBL: ENSMUSP00000065836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064447]
Predicted Effect possibly damaging
Transcript: ENSMUST00000064447
AA Change: T776A

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000065836
Gene: ENSMUSG00000052533
AA Change: T776A

DomainStartEndE-ValueType
Pfam:Nup188 31 941 9.3e-213 PFAM
low complexity region 1020 1035 N/A INTRINSIC
low complexity region 1307 1320 N/A INTRINSIC
low complexity region 1330 1360 N/A INTRINSIC
low complexity region 1696 1709 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133603
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141035
Meta Mutation Damage Score 0.0704 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear pore complex (NPC) is found on the nuclear envelope and forms a gateway that regulates the flow of proteins and RNAs between the cytoplasm and nucleoplasm. The NPC is comprised of approximately 30 distinct proteins collectively known as nucleoporins. Nucleoporins are pore-complex-specific glycoproteins which often have cytoplasmically oriented O-linked N-acetylglucosamine residues and numerous repeats of the pentapeptide sequence XFXFG. However, the nucleoporin protein encoded by this gene does not contain the typical FG repeat sequences found in most vertebrate nucleoporins. This nucleoporin is thought to form part of the scaffold for the central channel of the nuclear pore. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp T G 16: 56,650,753 V587G probably benign Het
Abtb2 A G 2: 103,717,287 D1002G probably benign Het
Acap2 A G 16: 31,108,126 S524P probably benign Het
Acsm1 A T 7: 119,655,464 I385L probably benign Het
Adra1a C G 14: 66,638,032 A152G probably benign Het
Agbl4 A T 4: 111,656,368 Y437F possibly damaging Het
Amt A G 9: 108,299,780 T196A probably benign Het
Apobr G A 7: 126,586,687 V457M probably benign Het
Birc6 A G 17: 74,649,672 K3563E probably damaging Het
Cdadc1 AGACGGA AGA 14: 59,568,991 probably null Het
Chrna9 T C 5: 65,977,149 W448R probably damaging Het
Cyp4a31 A T 4: 115,570,269 D224V probably damaging Het
Ddx10 C A 9: 53,204,105 R643L possibly damaging Het
Dip2c A G 13: 9,536,860 H200R probably benign Het
Dnah8 A T 17: 30,767,924 R3182S probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Egfr T C 11: 16,869,354 C295R probably damaging Het
Garem1 A T 18: 21,148,116 N394K probably damaging Het
Gcat T C 15: 79,031,122 probably null Het
Gckr C T 5: 31,298,300 Q66* probably null Het
Gm26996 A T 6: 130,579,354 noncoding transcript Het
Gm9386 C A 17: 80,938,712 noncoding transcript Het
Gpr6 A T 10: 41,071,262 M108K possibly damaging Het
H2-Q10 A C 17: 35,473,584 probably benign Het
Hpf1 A G 8: 60,893,807 D52G probably damaging Het
Jak2 A G 19: 29,301,977 R989G probably damaging Het
Kat7 A G 11: 95,303,123 probably benign Het
Kcnn3 G T 3: 89,662,724 V615F probably damaging Het
Lgi1 G T 19: 38,300,878 probably null Het
Lrrtm4 A T 6: 80,023,134 T510S possibly damaging Het
Map7d1 A G 4: 126,234,321 probably null Het
Mapt T C 11: 104,298,960 V252A probably benign Het
Mbd4 A T 6: 115,849,299 S223T possibly damaging Het
Meig1 T A 2: 3,411,922 I21L probably benign Het
Mia3 A G 1: 183,332,830 Y447H probably damaging Het
Mrpl46 A C 7: 78,780,595 N142K probably benign Het
Myo18a C A 11: 77,859,236 probably benign Het
Oas1h C A 5: 120,862,665 H113N probably damaging Het
Olfr1505 A T 19: 13,919,453 L144F possibly damaging Het
Olfr771 T A 10: 129,160,376 T203S possibly damaging Het
Olfr830 A G 9: 18,875,917 I197V probably benign Het
Olfr845 C T 9: 19,339,180 T240M probably damaging Het
Orc3 T A 4: 34,572,450 probably benign Het
Osbpl3 T A 6: 50,353,000 L65F probably damaging Het
Papola C A 12: 105,799,653 P4Q probably damaging Het
Pepd A G 7: 34,945,597 N151S probably damaging Het
Plekhm2 A G 4: 141,627,839 L959P probably benign Het
Prpf40a A T 2: 53,190,020 H82Q probably damaging Het
Robo1 C T 16: 72,972,035 T496M probably benign Het
Samd9l T G 6: 3,372,863 Q1466P probably damaging Het
Serpina1a T C 12: 103,854,763 T342A probably benign Het
Serpina3i A G 12: 104,265,211 T36A probably benign Het
Serpinb5 G T 1: 106,872,339 L86F probably damaging Het
Slc35g1 A G 19: 38,402,827 S186G possibly damaging Het
Slco6d1 T A 1: 98,423,174 D126E probably benign Het
Smchd1 A G 17: 71,411,768 probably null Het
Smpdl3a C A 10: 57,811,241 T355K probably damaging Het
Sntg2 A G 12: 30,373,268 probably benign Het
Sox14 T A 9: 99,875,231 M152L probably benign Het
Spats2l G T 1: 57,937,926 A308S possibly damaging Het
Tcf12 T C 9: 71,870,041 probably benign Het
Tcf7l2 T A 19: 55,924,072 C478* probably null Het
Tekt5 A G 16: 10,382,907 L250P probably damaging Het
Tmem132d T G 5: 127,984,264 I425L probably benign Het
Tmem174 T A 13: 98,636,948 I125F probably damaging Het
Trafd1 T G 5: 121,374,016 I404L probably benign Het
Trpm5 G A 7: 143,082,636 P500S possibly damaging Het
Trpm6 T A 19: 18,862,212 N1616K probably benign Het
Vmn1r4 A G 6: 56,956,730 D73G possibly damaging Het
Vmn2r85 T A 10: 130,418,698 I706F probably benign Het
Zc3h14 C G 12: 98,752,848 D157E probably damaging Het
Zfp982 A G 4: 147,512,633 Q149R possibly damaging Het
Other mutations in Nup188
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00908:Nup188 APN 2 30333400 missense probably damaging 0.98
IGL01599:Nup188 APN 2 30327525 missense possibly damaging 0.92
IGL01938:Nup188 APN 2 30329359 missense probably benign
IGL01973:Nup188 APN 2 30339850 missense possibly damaging 0.95
IGL02157:Nup188 APN 2 30329373 nonsense probably null
IGL02221:Nup188 APN 2 30330641 missense possibly damaging 0.75
IGL02277:Nup188 APN 2 30326511 missense possibly damaging 0.95
IGL02335:Nup188 APN 2 30323636 critical splice donor site probably null
IGL02986:Nup188 APN 2 30307633 unclassified probably null
IGL03029:Nup188 APN 2 30322580 splice site probably benign
IGL03194:Nup188 APN 2 30304334 missense possibly damaging 0.95
IGL03370:Nup188 APN 2 30340641 missense possibly damaging 0.52
P0027:Nup188 UTSW 2 30322681 missense probably damaging 0.99
R0006:Nup188 UTSW 2 30322023 missense probably benign 0.27
R0360:Nup188 UTSW 2 30326479 missense probably null 0.93
R0373:Nup188 UTSW 2 30330988 missense probably damaging 1.00
R0645:Nup188 UTSW 2 30343466 unclassified probably null
R1411:Nup188 UTSW 2 30343795 missense probably benign 0.01
R1670:Nup188 UTSW 2 30340655 missense probably benign 0.19
R2034:Nup188 UTSW 2 30310085 unclassified probably benign
R2113:Nup188 UTSW 2 30304101 nonsense probably null
R2142:Nup188 UTSW 2 30336706 missense possibly damaging 0.49
R2221:Nup188 UTSW 2 30336924 splice site probably benign
R2567:Nup188 UTSW 2 30341782 missense possibly damaging 0.53
R2964:Nup188 UTSW 2 30325346 missense probably damaging 0.98
R4006:Nup188 UTSW 2 30309878 missense probably damaging 0.99
R4007:Nup188 UTSW 2 30309878 missense probably damaging 0.99
R4079:Nup188 UTSW 2 30309878 missense probably damaging 0.99
R4480:Nup188 UTSW 2 30322129 intron probably benign
R4628:Nup188 UTSW 2 30329346 missense probably damaging 1.00
R4687:Nup188 UTSW 2 30330633 missense probably benign 0.01
R4834:Nup188 UTSW 2 30339584 missense probably damaging 1.00
R5038:Nup188 UTSW 2 30309220 missense probably damaging 0.98
R5056:Nup188 UTSW 2 30304131 missense probably damaging 0.98
R5124:Nup188 UTSW 2 30330935 missense probably damaging 1.00
R5256:Nup188 UTSW 2 30330749 missense probably damaging 1.00
R5284:Nup188 UTSW 2 30330635 missense probably damaging 1.00
R5548:Nup188 UTSW 2 30326493 missense probably damaging 0.99
R5560:Nup188 UTSW 2 30309885 missense probably damaging 0.99
R5668:Nup188 UTSW 2 30336324 missense probably damaging 1.00
R5769:Nup188 UTSW 2 30330735 missense probably benign 0.34
R5773:Nup188 UTSW 2 30322196 missense possibly damaging 0.92
R5774:Nup188 UTSW 2 30301048 missense probably damaging 1.00
R5827:Nup188 UTSW 2 30339847 missense probably damaging 1.00
R5919:Nup188 UTSW 2 30339894 missense probably damaging 1.00
R5923:Nup188 UTSW 2 30304090 missense probably benign
R6185:Nup188 UTSW 2 30341710 missense probably damaging 0.97
R6457:Nup188 UTSW 2 30322187 missense probably damaging 0.98
R6529:Nup188 UTSW 2 30326454 missense possibly damaging 0.95
R7002:Nup188 UTSW 2 30323568 missense probably damaging 0.99
R7195:Nup188 UTSW 2 30341830 critical splice donor site probably null
R7214:Nup188 UTSW 2 30307554 missense possibly damaging 0.71
R7345:Nup188 UTSW 2 30340601 missense probably benign 0.09
T0722:Nup188 UTSW 2 30322681 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCAAGTCTGAGAAAAGTGTTCAGAAT -3'
(R):5'- CACTAGCTAGGAAATACAAGGAGT -3'

Sequencing Primer
(F):5'- GAATATCTTCCTTCCACAGACAGTTG -3'
(R):5'- ACTGTGGCTCCAGGCTTAAAC -3'
Posted On2016-02-04