Incidental Mutation 'R4993:Klf4'
ID384988
Institutional Source Beutler Lab
Gene Symbol Klf4
Ensembl Gene ENSMUSG00000003032
Gene NameKruppel-like factor 4 (gut)
SynonymsZie, EZF, Gklf
MMRRC Submission 042587-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4993 (G1)
Quality Score177
Status Not validated
Chromosome4
Chromosomal Location55527143-55532466 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 55530640 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 148 (P148Q)
Ref Sequence ENSEMBL: ENSMUSP00000116514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107619] [ENSMUST00000129250] [ENSMUST00000132746]
Predicted Effect possibly damaging
Transcript: ENSMUST00000107619
AA Change: P157Q

PolyPhen 2 Score 0.824 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103245
Gene: ENSMUSG00000003032
AA Change: P157Q

DomainStartEndE-ValueType
low complexity region 116 144 N/A INTRINSIC
low complexity region 211 221 N/A INTRINSIC
low complexity region 235 252 N/A INTRINSIC
low complexity region 335 357 N/A INTRINSIC
ZnF_C2H2 400 424 1.82e-3 SMART
ZnF_C2H2 430 454 4.3e-5 SMART
ZnF_C2H2 460 482 8.47e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000129250
AA Change: P148Q

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000116514
Gene: ENSMUSG00000003032
AA Change: P148Q

DomainStartEndE-ValueType
low complexity region 107 135 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132746
SMART Domains Protein: ENSMUSP00000123687
Gene: ENSMUSG00000003032

DomainStartEndE-ValueType
low complexity region 66 82 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the Kruppel family of transcription factors. The encoded zinc finger protein is required for normal development of the barrier function of skin. The encoded protein is thought to control the G1-to-S transition of the cell cycle following DNA damage by mediating the tumor suppressor gene p53. Mice lacking this gene have a normal appearance but lose weight rapidly, and die shortly after birth due to fluid evaporation resulting from compromised epidermal barrier function. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for targeted null mutations die shortly after birth due to a skin defect that results in loss of fluids. Mutants also show a dramatic decrease in the number of goblet cells of the colon. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
9130008F23Rik G T 17: 40,880,161 Q126K probably benign Het
Abca15 C A 7: 120,401,718 N1492K probably damaging Het
Afap1l2 C T 19: 56,918,040 D402N probably damaging Het
Akap11 A G 14: 78,512,968 F660L probably damaging Het
Bcl3 T C 7: 19,820,177 T89A probably benign Het
Bub1b T C 2: 118,636,770 I858T possibly damaging Het
Cdk19 A G 10: 40,476,218 D288G possibly damaging Het
Cyp2d34 T A 15: 82,618,329 D202V probably damaging Het
Dip2c T G 13: 9,575,223 Y584* probably null Het
Dpf3 A T 12: 83,331,861 probably null Het
Drp2 G A X: 134,441,316 R567H probably damaging Homo
Emid1 G T 11: 5,131,512 Q212K probably benign Het
Esm1 C T 13: 113,213,399 Q118* probably null Het
Fahd2a T G 2: 127,436,364 I308L probably benign Het
Fam208a T A 14: 27,429,114 W16R possibly damaging Het
Fanci T C 7: 79,435,378 *851Q probably null Het
Fastkd1 C A 2: 69,702,740 V428F probably damaging Het
Fat2 A T 11: 55,283,092 I2265N probably damaging Het
Gale C A 4: 135,966,860 H191Q probably damaging Het
Ghsr T A 3: 27,372,254 V153E possibly damaging Het
Gm10696 C T 3: 94,176,316 G63R probably damaging Het
Gpc6 A G 14: 117,624,539 N289S possibly damaging Het
Hoxb6 A T 11: 96,300,711 Y153F probably damaging Het
Ints3 T C 3: 90,415,507 T139A probably benign Het
Irf2bp2 A G 8: 126,592,671 S256P probably benign Het
Loxl1 T G 9: 58,312,537 H117P probably damaging Het
Lpl A G 8: 68,895,793 K225E probably benign Het
Lrba T A 3: 86,360,037 V1678D probably damaging Het
Med1 A T 11: 98,163,904 F398Y probably damaging Het
Mfap2 T C 4: 141,015,578 *186Q probably null Het
Mfsd3 T C 15: 76,701,982 L105P probably damaging Het
Mlxip T G 5: 123,395,294 I122S probably damaging Het
Mmrn2 A T 14: 34,396,398 Y107F probably damaging Het
Mtg1 G T 7: 140,140,283 D88Y probably null Het
Mutyh T A 4: 116,817,935 S426R probably benign Het
Myo16 C T 8: 10,476,094 T878I probably damaging Het
Myo9a T A 9: 59,861,472 Y912* probably null Het
Ncor1 A C 11: 62,343,341 I669R probably damaging Het
Ndufs1 T C 1: 63,163,776 I210V probably benign Het
Nek9 A G 12: 85,310,420 C657R probably damaging Het
Noct C T 3: 51,250,021 T260I probably damaging Het
Nr1h4 A T 10: 89,498,180 M102K probably benign Het
Obscn G A 11: 59,124,761 R1054C possibly damaging Het
Olfr1124 T A 2: 87,435,152 F222I probably benign Het
Olfr352 C A 2: 36,869,988 Q141K probably benign Het
Olfr47 A G 6: 43,236,456 M283V possibly damaging Het
Olfr501-ps1 G A 7: 108,508,243 M62I probably damaging Het
Olfr615 T A 7: 103,561,317 I280N possibly damaging Het
Olfr619 A T 7: 103,603,656 M1L probably benign Het
Otol1 C A 3: 70,018,878 Q129K probably benign Het
Otx1 A T 11: 21,998,532 probably null Het
Pcdhac2 C A 18: 37,146,251 N761K probably damaging Het
Pde1c A T 6: 56,150,624 M452K probably damaging Het
Phkg2 T C 7: 127,573,941 Y24H probably damaging Het
Pigr G A 1: 130,841,817 D122N probably benign Het
Prg4 C T 1: 150,460,681 C97Y probably damaging Het
Ptdss1 T C 13: 66,945,288 V64A probably benign Het
Ralgapa2 T C 2: 146,447,311 K324E probably damaging Het
Rfx5 G A 3: 94,955,815 V73I probably benign Het
Riiad1 T C 3: 94,472,863 T42A probably benign Het
Rims2 T C 15: 39,454,445 V640A possibly damaging Het
Rnpep G T 1: 135,263,032 S592Y possibly damaging Het
Scap T C 9: 110,378,390 L431P probably damaging Het
Siglec1 T A 2: 131,073,361 I1437F possibly damaging Het
Skint1 T C 4: 112,028,333 probably null Het
Slc44a1 A G 4: 53,543,644 E396G probably damaging Het
Slc4a2 T C 5: 24,434,869 F521S probably damaging Het
Smarcc1 T A 9: 110,175,061 S394R probably damaging Het
Socs1 A G 16: 10,784,685 S63P probably benign Het
Sun1 T G 5: 139,225,333 S20A possibly damaging Het
Tac4 A T 11: 95,265,242 K50* probably null Het
Tcaf2 A G 6: 42,642,640 I151T probably damaging Het
Tcf4 T C 18: 69,681,769 V587A probably damaging Het
Ttc37 T A 13: 76,182,936 M1495K probably damaging Het
Ttn T A 2: 76,740,909 K24801* probably null Het
Tuba3b G T 6: 145,621,273 M413I possibly damaging Het
Ufl1 C T 4: 25,267,832 A280T possibly damaging Het
Ugt2b5 T A 5: 87,139,673 I212L probably benign Het
Umodl1 A G 17: 30,986,485 T685A probably benign Het
Uqcrc1 T A 9: 108,944,810 V183D probably damaging Het
Ush2a A G 1: 188,910,720 N4093S probably benign Het
Vmn1r167 C T 7: 23,505,228 S121N probably damaging Het
Vmn1r47 A G 6: 90,022,758 S291G possibly damaging Het
Vmn2r108 A G 17: 20,481,187 V17A probably benign Het
Vmn2r58 T A 7: 41,837,752 H573L probably benign Het
Xirp1 C T 9: 120,018,792 V342I probably damaging Het
Zfp462 A G 4: 55,051,204 M2226V possibly damaging Het
Zfp467 G A 6: 48,439,029 H230Y probably damaging Het
Zfp595 T A 13: 67,316,401 K599N probably damaging Het
Zfp819 C A 7: 43,617,296 T401K probably benign Het
Other mutations in Klf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01928:Klf4 APN 4 55530949 missense probably benign 0.14
IGL02602:Klf4 APN 4 55530595 missense probably damaging 0.99
IGL03088:Klf4 APN 4 55530758 missense possibly damaging 0.52
IGL03088:Klf4 APN 4 55530811 missense probably damaging 1.00
IGL03185:Klf4 APN 4 55530911 missense possibly damaging 0.65
R0846:Klf4 UTSW 4 55530191 missense probably damaging 0.99
R1815:Klf4 UTSW 4 55530977 missense probably benign 0.24
R1816:Klf4 UTSW 4 55530977 missense probably benign 0.24
R4180:Klf4 UTSW 4 55530884 missense possibly damaging 0.96
R4625:Klf4 UTSW 4 55530370 missense probably benign 0.39
R5021:Klf4 UTSW 4 55530970 missense probably damaging 1.00
R5033:Klf4 UTSW 4 55530301 missense probably benign 0.23
R5113:Klf4 UTSW 4 55530481 missense possibly damaging 0.94
R6569:Klf4 UTSW 4 55530394 missense probably damaging 1.00
R7941:Klf4 UTSW 4 55531755 intron probably benign
Predicted Primers PCR Primer
(F):5'- GCCTTCAGCACAAACTTGCC -3'
(R):5'- TTCAACGACCTCCTGGACCTAG -3'

Sequencing Primer
(F):5'- ACTTGCCCATCAGCCCG -3'
(R):5'- GACCTCCTGGACCTAGACTTTATC -3'
Posted On2016-05-10