Incidental Mutation 'R4993:Fam208a'
ID385046
Institutional Source Beutler Lab
Gene Symbol Fam208a
Ensembl Gene ENSMUSG00000040651
Gene Namefamily with sequence similarity 208, member A
SynonymsD14Abb1e, 4933409E02Rik
MMRRC Submission 042587-MU
Accession Numbers

Ensembl: ENSMUST00000059031; MGI: 1921694

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4993 (G1)
Quality Score169
Status Not validated
Chromosome14
Chromosomal Location27428834-27483555 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 27429114 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 16 (W16R)
Ref Sequence ENSEMBL: ENSMUSP00000022450 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022450]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022450
AA Change: W16R

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000022450
Gene: ENSMUSG00000040651
AA Change: W16R

DomainStartEndE-ValueType
low complexity region 20 27 N/A INTRINSIC
low complexity region 42 61 N/A INTRINSIC
low complexity region 74 88 N/A INTRINSIC
Pfam:DUF3715 153 314 1.5e-55 PFAM
low complexity region 442 457 N/A INTRINSIC
low complexity region 1087 1102 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for ENU mutations are not viable past gastrulation. [provided by MGI curators]
Allele List at MGI

All alleles(26) : Gene trapped(26)

Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
9130008F23Rik G T 17: 40,880,161 Q126K probably benign Het
Abca15 C A 7: 120,401,718 N1492K probably damaging Het
Afap1l2 C T 19: 56,918,040 D402N probably damaging Het
Akap11 A G 14: 78,512,968 F660L probably damaging Het
Bcl3 T C 7: 19,820,177 T89A probably benign Het
Bub1b T C 2: 118,636,770 I858T possibly damaging Het
Cdk19 A G 10: 40,476,218 D288G possibly damaging Het
Cyp2d34 T A 15: 82,618,329 D202V probably damaging Het
Dip2c T G 13: 9,575,223 Y584* probably null Het
Dpf3 A T 12: 83,331,861 probably null Het
Drp2 G A X: 134,441,316 R567H probably damaging Homo
Emid1 G T 11: 5,131,512 Q212K probably benign Het
Esm1 C T 13: 113,213,399 Q118* probably null Het
Fahd2a T G 2: 127,436,364 I308L probably benign Het
Fanci T C 7: 79,435,378 *851Q probably null Het
Fastkd1 C A 2: 69,702,740 V428F probably damaging Het
Fat2 A T 11: 55,283,092 I2265N probably damaging Het
Gale C A 4: 135,966,860 H191Q probably damaging Het
Ghsr T A 3: 27,372,254 V153E possibly damaging Het
Gm10696 C T 3: 94,176,316 G63R probably damaging Het
Gpc6 A G 14: 117,624,539 N289S possibly damaging Het
Hoxb6 A T 11: 96,300,711 Y153F probably damaging Het
Ints3 T C 3: 90,415,507 T139A probably benign Het
Irf2bp2 A G 8: 126,592,671 S256P probably benign Het
Klf4 G T 4: 55,530,640 P148Q probably damaging Het
Loxl1 T G 9: 58,312,537 H117P probably damaging Het
Lpl A G 8: 68,895,793 K225E probably benign Het
Lrba T A 3: 86,360,037 V1678D probably damaging Het
Med1 A T 11: 98,163,904 F398Y probably damaging Het
Mfap2 T C 4: 141,015,578 *186Q probably null Het
Mfsd3 T C 15: 76,701,982 L105P probably damaging Het
Mlxip T G 5: 123,395,294 I122S probably damaging Het
Mmrn2 A T 14: 34,396,398 Y107F probably damaging Het
Mtg1 G T 7: 140,140,283 D88Y probably null Het
Mutyh T A 4: 116,817,935 S426R probably benign Het
Myo16 C T 8: 10,476,094 T878I probably damaging Het
Myo9a T A 9: 59,861,472 Y912* probably null Het
Ncor1 A C 11: 62,343,341 I669R probably damaging Het
Ndufs1 T C 1: 63,163,776 I210V probably benign Het
Nek9 A G 12: 85,310,420 C657R probably damaging Het
Noct C T 3: 51,250,021 T260I probably damaging Het
Nr1h4 A T 10: 89,498,180 M102K probably benign Het
Obscn G A 11: 59,124,761 R1054C possibly damaging Het
Olfr1124 T A 2: 87,435,152 F222I probably benign Het
Olfr352 C A 2: 36,869,988 Q141K probably benign Het
Olfr47 A G 6: 43,236,456 M283V possibly damaging Het
Olfr501-ps1 G A 7: 108,508,243 M62I probably damaging Het
Olfr615 T A 7: 103,561,317 I280N possibly damaging Het
Olfr619 A T 7: 103,603,656 M1L probably benign Het
Otol1 C A 3: 70,018,878 Q129K probably benign Het
Otx1 A T 11: 21,998,532 probably null Het
Pcdhac2 C A 18: 37,146,251 N761K probably damaging Het
Pde1c A T 6: 56,150,624 M452K probably damaging Het
Phkg2 T C 7: 127,573,941 Y24H probably damaging Het
Pigr G A 1: 130,841,817 D122N probably benign Het
Prg4 C T 1: 150,460,681 C97Y probably damaging Het
Ptdss1 T C 13: 66,945,288 V64A probably benign Het
Ralgapa2 T C 2: 146,447,311 K324E probably damaging Het
Rfx5 G A 3: 94,955,815 V73I probably benign Het
Riiad1 T C 3: 94,472,863 T42A probably benign Het
Rims2 T C 15: 39,454,445 V640A possibly damaging Het
Rnpep G T 1: 135,263,032 S592Y possibly damaging Het
Scap T C 9: 110,378,390 L431P probably damaging Het
Siglec1 T A 2: 131,073,361 I1437F possibly damaging Het
Skint1 T C 4: 112,028,333 probably null Het
Slc44a1 A G 4: 53,543,644 E396G probably damaging Het
Slc4a2 T C 5: 24,434,869 F521S probably damaging Het
Smarcc1 T A 9: 110,175,061 S394R probably damaging Het
Socs1 A G 16: 10,784,685 S63P probably benign Het
Sun1 T G 5: 139,225,333 S20A possibly damaging Het
Tac4 A T 11: 95,265,242 K50* probably null Het
Tcaf2 A G 6: 42,642,640 I151T probably damaging Het
Tcf4 T C 18: 69,681,769 V587A probably damaging Het
Ttc37 T A 13: 76,182,936 M1495K probably damaging Het
Ttn T A 2: 76,740,909 K24801* probably null Het
Tuba3b G T 6: 145,621,273 M413I possibly damaging Het
Ufl1 C T 4: 25,267,832 A280T possibly damaging Het
Ugt2b5 T A 5: 87,139,673 I212L probably benign Het
Umodl1 A G 17: 30,986,485 T685A probably benign Het
Uqcrc1 T A 9: 108,944,810 V183D probably damaging Het
Ush2a A G 1: 188,910,720 N4093S probably benign Het
Vmn1r167 C T 7: 23,505,228 S121N probably damaging Het
Vmn1r47 A G 6: 90,022,758 S291G possibly damaging Het
Vmn2r108 A G 17: 20,481,187 V17A probably benign Het
Vmn2r58 T A 7: 41,837,752 H573L probably benign Het
Xirp1 C T 9: 120,018,792 V342I probably damaging Het
Zfp462 A G 4: 55,051,204 M2226V possibly damaging Het
Zfp467 G A 6: 48,439,029 H230Y probably damaging Het
Zfp595 T A 13: 67,316,401 K599N probably damaging Het
Zfp819 C A 7: 43,617,296 T401K probably benign Het
Other mutations in Fam208a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Fam208a APN 14 27448206 missense probably damaging 1.00
IGL00467:Fam208a APN 14 27448164 missense probably benign 0.02
IGL01071:Fam208a APN 14 27442622 critical splice donor site probably null
IGL01351:Fam208a APN 14 27464301 missense probably benign 0.02
IGL01375:Fam208a APN 14 27440163 missense probably damaging 1.00
IGL01509:Fam208a APN 14 27459774 splice site probably benign
IGL02342:Fam208a APN 14 27476667 missense possibly damaging 0.83
IGL03105:Fam208a APN 14 27442552 missense probably damaging 0.98
IGL03131:Fam208a APN 14 27461179 nonsense probably null
IGL03248:Fam208a APN 14 27476692 missense probably damaging 1.00
IGL03383:Fam208a APN 14 27441961 missense possibly damaging 0.93
balsam UTSW 14 27461150 missense probably benign 0.01
santa_rosa UTSW 14 27476701 splice site probably null
D4043:Fam208a UTSW 14 27471992 missense probably benign 0.07
R0147:Fam208a UTSW 14 27471768 missense probably benign 0.23
R0512:Fam208a UTSW 14 27446406 missense probably damaging 1.00
R0589:Fam208a UTSW 14 27461150 missense probably benign 0.01
R0609:Fam208a UTSW 14 27461750 missense probably benign 0.09
R0798:Fam208a UTSW 14 27476636 missense probably damaging 1.00
R1107:Fam208a UTSW 14 27479723 nonsense probably null
R1205:Fam208a UTSW 14 27461318 missense probably damaging 1.00
R1376:Fam208a UTSW 14 27429381 missense probably benign 0.00
R1376:Fam208a UTSW 14 27429381 missense probably benign 0.00
R1441:Fam208a UTSW 14 27464260 nonsense probably null
R1493:Fam208a UTSW 14 27449969 missense probably damaging 1.00
R1527:Fam208a UTSW 14 27480093 critical splice donor site probably null
R1729:Fam208a UTSW 14 27479633 missense probably damaging 1.00
R1752:Fam208a UTSW 14 27471928 nonsense probably null
R1960:Fam208a UTSW 14 27438664 missense probably damaging 1.00
R1960:Fam208a UTSW 14 27479789 missense possibly damaging 0.95
R1965:Fam208a UTSW 14 27442554 missense probably damaging 1.00
R2074:Fam208a UTSW 14 27461213 missense probably benign 0.03
R2107:Fam208a UTSW 14 27461787 critical splice donor site probably null
R2130:Fam208a UTSW 14 27446388 missense probably damaging 1.00
R2130:Fam208a UTSW 14 27476614 missense possibly damaging 0.74
R2131:Fam208a UTSW 14 27476614 missense possibly damaging 0.74
R2133:Fam208a UTSW 14 27476614 missense possibly damaging 0.74
R2140:Fam208a UTSW 14 27480035 missense probably damaging 1.00
R2184:Fam208a UTSW 14 27466184 missense possibly damaging 0.83
R2279:Fam208a UTSW 14 27442495 missense probably damaging 1.00
R3979:Fam208a UTSW 14 27477130 missense possibly damaging 0.95
R4113:Fam208a UTSW 14 27459961 nonsense probably null
R4434:Fam208a UTSW 14 27449861 critical splice donor site probably null
R4562:Fam208a UTSW 14 27466308 missense possibly damaging 0.67
R4568:Fam208a UTSW 14 27476701 splice site probably null
R4754:Fam208a UTSW 14 27461095 missense probably benign
R4980:Fam208a UTSW 14 27461425 missense probably benign 0.39
R5200:Fam208a UTSW 14 27429226 missense probably benign 0.41
R5316:Fam208a UTSW 14 27472035 missense possibly damaging 0.52
R5599:Fam208a UTSW 14 27479929 missense probably benign 0.01
R5678:Fam208a UTSW 14 27429123 small insertion probably benign
R5680:Fam208a UTSW 14 27429123 small insertion probably benign
R5887:Fam208a UTSW 14 27466297 nonsense probably null
R6181:Fam208a UTSW 14 27472278 missense probably benign 0.01
R6556:Fam208a UTSW 14 27429258 missense probably benign
R6603:Fam208a UTSW 14 27446386 missense probably damaging 1.00
R6829:Fam208a UTSW 14 27442481 missense possibly damaging 0.90
R6864:Fam208a UTSW 14 27461158 missense probably damaging 0.96
R6919:Fam208a UTSW 14 27449801 nonsense probably null
R7046:Fam208a UTSW 14 27472435 missense probably damaging 1.00
R7057:Fam208a UTSW 14 27461651 missense probably damaging 0.97
R7064:Fam208a UTSW 14 27472331 missense probably benign 0.09
R7290:Fam208a UTSW 14 27438653 missense probably damaging 1.00
R7303:Fam208a UTSW 14 27471852 missense probably damaging 1.00
R7439:Fam208a UTSW 14 27471645 missense probably damaging 1.00
R7524:Fam208a UTSW 14 27466203 missense probably damaging 0.99
R7580:Fam208a UTSW 14 27466286 missense probably benign 0.29
R7726:Fam208a UTSW 14 27447497 missense probably damaging 0.99
R7771:Fam208a UTSW 14 27467559 missense probably damaging 1.00
R7782:Fam208a UTSW 14 27471944 missense probably benign 0.07
R7795:Fam208a UTSW 14 27481383 missense
R7835:Fam208a UTSW 14 27476643 missense probably damaging 1.00
R7954:Fam208a UTSW 14 27447524 critical splice donor site probably null
R7981:Fam208a UTSW 14 27446416 missense possibly damaging 0.49
R8101:Fam208a UTSW 14 27442481 missense possibly damaging 0.90
R8160:Fam208a UTSW 14 27449956 missense probably damaging 1.00
R8307:Fam208a UTSW 14 27471665 missense probably damaging 1.00
X0002:Fam208a UTSW 14 27472106 missense possibly damaging 0.90
Z1176:Fam208a UTSW 14 27429208 missense probably damaging 0.97
Z1176:Fam208a UTSW 14 27477148 missense probably damaging 1.00
Z1177:Fam208a UTSW 14 27448250 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGAAAAGCCGCCCGAATCC -3'
(R):5'- GATCTGAAAACTCCGCCTAAAAGG -3'

Sequencing Primer
(F):5'- GCGGTTAAGAGGCGTCTC -3'
(R):5'- CTCTTCGGCGCCTTTGGG -3'
Posted On2016-05-10