Incidental Mutation 'R5299:Ube2g2'
ID 405573
Institutional Source Beutler Lab
Gene Symbol Ube2g2
Ensembl Gene ENSMUSG00000009293
Gene Name ubiquitin-conjugating enzyme E2G 2
Synonyms UBC7, D10Xrf369, 1110003O05Rik, Ubc7p
MMRRC Submission 042882-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.724) question?
Stock # R5299 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 77458155-77481824 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 77480379 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 162 (S162P)
Ref Sequence ENSEMBL: ENSMUSP00000133515 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172813] [ENSMUST00000174113] [ENSMUST00000174510] [ENSMUST00000174546]
AlphaFold P60605
PDB Structure Crystal structure of the ubiquitin conjugating enzyme Ube2g2 bound to the G2BR domain of ubiquitin ligase gp78 [X-RAY DIFFRACTION]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158799
Predicted Effect probably benign
Transcript: ENSMUST00000172772
SMART Domains Protein: ENSMUSP00000134397
Gene: ENSMUSG00000009293

DomainStartEndE-ValueType
SCOP:d2ucz__ 2 41 7e-12 SMART
PDB:3H8K|A 2 96 3e-24 PDB
Blast:UBCc 6 96 3e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000172813
SMART Domains Protein: ENSMUSP00000134670
Gene: ENSMUSG00000009293

DomainStartEndE-ValueType
UBCc 1 70 1.2e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173360
Predicted Effect probably benign
Transcript: ENSMUST00000174113
SMART Domains Protein: ENSMUSP00000134357
Gene: ENSMUSG00000112241

DomainStartEndE-ValueType
UBQ 17 74 4.07e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000174510
AA Change: S162P

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000133515
Gene: ENSMUSG00000009293
AA Change: S162P

DomainStartEndE-ValueType
UBCc 7 164 1.33e-64 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174546
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. The encoded protein shares 100% sequence identity with the mouse counterpart. This gene is ubiquitously expressed, with high expression seen in adult muscle. Three alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,381,861 (GRCm39) I3838V probably damaging Het
Arid1a A T 4: 133,414,537 (GRCm39) D1231E unknown Het
Atxn1 A T 13: 45,710,730 (GRCm39) I734K probably benign Het
Axin1 A G 17: 26,392,708 (GRCm39) S330G probably damaging Het
Bend3 G A 10: 43,369,686 (GRCm39) probably null Het
Chodl C T 16: 78,738,296 (GRCm39) T88I probably damaging Het
Dnah2 C T 11: 69,349,746 (GRCm39) R2399Q probably benign Het
Dst A G 1: 34,174,173 (GRCm39) I179M probably damaging Het
Ehmt2 C T 17: 35,118,067 (GRCm39) R40* probably null Het
Exoc2 A T 13: 31,055,901 (GRCm39) probably null Het
Grk2 T C 19: 4,342,799 (GRCm39) E45G probably damaging Het
Ift81 T C 5: 122,745,119 (GRCm39) Y144C probably damaging Het
Ighv1-15 T C 12: 114,620,998 (GRCm39) D109G probably damaging Het
Igtp T C 11: 58,097,959 (GRCm39) W377R possibly damaging Het
Lgr6 C T 1: 134,921,748 (GRCm39) A199T probably damaging Het
Map2k6 A G 11: 110,383,789 (GRCm39) D145G probably benign Het
Mcph1 T C 8: 18,702,596 (GRCm39) probably benign Het
Mdfi A G 17: 48,131,759 (GRCm39) V95A possibly damaging Het
Mical3 A G 6: 120,936,473 (GRCm39) L1351P possibly damaging Het
Nbas C T 12: 13,491,926 (GRCm39) Q1506* probably null Het
Nelfb A G 2: 25,100,757 (GRCm39) V128A probably benign Het
Otog A G 7: 45,938,275 (GRCm39) T1995A probably benign Het
Ppp1r7 A T 1: 93,280,348 (GRCm39) I139L probably benign Het
Ppp2r1b A G 9: 50,768,340 (GRCm39) D19G probably benign Het
Proca1 T C 11: 78,096,078 (GRCm39) S150P probably damaging Het
Rhof A G 5: 123,258,611 (GRCm39) V100A probably damaging Het
Rsbn1 G C 3: 103,821,806 (GRCm39) G14R probably benign Het
Serinc1 A G 10: 57,399,147 (GRCm39) I252T probably damaging Het
Skint4 A T 4: 111,993,203 (GRCm39) I309F possibly damaging Het
Slc12a3 A G 8: 95,078,417 (GRCm39) Y815C probably damaging Het
Slc25a24 A G 3: 109,073,668 (GRCm39) S424G probably benign Het
Spint2 G A 7: 28,963,151 (GRCm39) A49V probably damaging Het
Traf3ip3 T A 1: 192,860,483 (GRCm39) K480* probably null Het
Ubxn8 C A 8: 34,131,947 (GRCm39) V7L possibly damaging Het
Vmn1r200 T A 13: 22,579,945 (GRCm39) C249* probably null Het
Vmn1r38 T A 6: 66,753,682 (GRCm39) T145S probably benign Het
Wapl G A 14: 34,455,765 (GRCm39) probably null Het
Wfdc6a T C 2: 164,422,311 (GRCm39) N96S possibly damaging Het
Zfp503 A G 14: 22,035,507 (GRCm39) S470P probably benign Het
Other mutations in Ube2g2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03348:Ube2g2 APN 10 77,466,711 (GRCm39) missense probably benign 0.05
R0180:Ube2g2 UTSW 10 77,466,573 (GRCm39) missense possibly damaging 0.87
R6077:Ube2g2 UTSW 10 77,458,139 (GRCm39) unclassified probably benign
R6454:Ube2g2 UTSW 10 77,470,580 (GRCm39) intron probably benign
R7831:Ube2g2 UTSW 10 77,470,576 (GRCm39) missense
R9004:Ube2g2 UTSW 10 77,479,434 (GRCm39) missense probably benign 0.04
R9751:Ube2g2 UTSW 10 77,480,307 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTTCCTACCCATAATGACCCTTGAG -3'
(R):5'- ACACAGCAGGAGGAGTCTTTAG -3'

Sequencing Primer
(F):5'- CCATAATGACCCTTGAGATCTGTGG -3'
(R):5'- AGGAGTCTTTAGCAGCGC -3'
Posted On 2016-07-22