Incidental Mutation 'R5489:Caln1'
ID431973
Institutional Source Beutler Lab
Gene Symbol Caln1
Ensembl Gene ENSMUSG00000060371
Gene Namecalneuron 1
Synonyms9630012C17Rik, Cabp8
MMRRC Submission 043050-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R5489 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location130369455-130847412 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 130414832 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 2 (R2L)
Ref Sequence ENSEMBL: ENSMUSP00000143823 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086029] [ENSMUST00000202728]
Predicted Effect probably benign
Transcript: ENSMUST00000086029
AA Change: R2L

PolyPhen 2 Score 0.167 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000083193
Gene: ENSMUSG00000060371
AA Change: R2L

DomainStartEndE-ValueType
EFh 82 110 2.98e-9 SMART
EFh 118 146 2.06e-3 SMART
low complexity region 195 204 N/A INTRINSIC
transmembrane domain 234 256 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000202728
AA Change: R2L

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
Meta Mutation Damage Score 0.0684 question?
Coding Region Coverage
  • 1x: 98.4%
  • 3x: 97.4%
  • 10x: 95.4%
  • 20x: 91.6%
Validation Efficiency 95% (57/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with high similarity to the calcium-binding proteins of the calmodulin family. The encoded protein contains two EF-hand domains and potential calcium-binding sites. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730455P16Rik A T 11: 80,377,952 M1K probably null Het
Abca14 T A 7: 120,252,250 V817D probably damaging Het
Aqr T C 2: 114,133,073 N632S probably damaging Het
Bms1 T C 6: 118,413,745 T208A possibly damaging Het
Brd8 A T 18: 34,608,645 probably null Het
Cdk17 A G 10: 93,232,412 T344A probably damaging Het
Chd8 A T 14: 52,213,048 probably benign Het
Clec14a A G 12: 58,268,249 F196L probably damaging Het
Clec2f T C 6: 129,020,486 noncoding transcript Het
Col4a1 A T 8: 11,312,550 probably benign Het
Col9a3 G A 2: 180,616,525 R579H probably damaging Het
Cyb561 A G 11: 105,935,523 V202A probably benign Het
Cyp2c69 T G 19: 39,851,159 Q340P probably null Het
D630003M21Rik T A 2: 158,217,021 T320S probably benign Het
D630045J12Rik A T 6: 38,196,847 S129T possibly damaging Het
Ddx54 A G 5: 120,624,721 T636A probably benign Het
Dnah8 T G 17: 30,790,956 F3774V probably damaging Het
Ern1 A G 11: 106,407,529 S674P probably damaging Het
Fam13a A T 6: 59,024,318 L8Q probably null Het
Fam83b T C 9: 76,545,599 N62S probably benign Het
Foxred1 A T 9: 35,209,970 V94E probably damaging Het
Frmd8 T A 19: 5,852,652 Q457L probably damaging Het
Gm1966 T A 7: 106,601,590 noncoding transcript Het
Heatr6 A G 11: 83,774,432 E741G probably damaging Het
Hnrnpab A G 11: 51,604,813 L133S probably damaging Het
Itga2 A T 13: 114,843,435 W1077R probably damaging Het
Kat6b A G 14: 21,669,264 D1228G probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Kmt2a A T 9: 44,841,038 probably benign Het
Leap2 T G 11: 53,422,413 *77C probably null Het
Mmp20 A G 9: 7,643,957 probably null Het
Mrps9 T G 1: 42,898,433 probably benign Het
Muc2 T C 7: 141,751,432 S158P probably benign Het
Mus81 T C 19: 5,487,889 probably benign Het
Nrip3 T C 7: 109,761,838 T210A probably damaging Het
Olfr591 T C 7: 103,173,451 Y62C probably damaging Het
Padi2 T C 4: 140,944,488 F509S probably damaging Het
Pcdha12 A G 18: 37,022,207 T660A probably benign Het
Pdzd2 G A 15: 12,382,676 P1197L probably benign Het
Rec8 A T 14: 55,622,826 Q291L probably benign Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Sart3 A G 5: 113,771,380 W86R probably damaging Het
Slc17a4 A G 13: 23,898,842 probably null Het
Tdpoz1 T A 3: 93,670,667 Y270F possibly damaging Het
Thap3 T A 4: 151,985,652 probably benign Het
Tmem45a T A 16: 56,825,711 probably null Het
Trim43a A T 9: 88,582,176 I47F probably damaging Het
Vps13b A T 15: 35,770,542 I2044L probably benign Het
Zfp735 G A 11: 73,710,593 W121* probably null Het
Zmym2 A G 14: 56,956,255 K1176E possibly damaging Het
Other mutations in Caln1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:Caln1 APN 5 130669551 missense probably damaging 1.00
IGL03152:Caln1 APN 5 130617852 missense probably damaging 0.97
IGL03409:Caln1 APN 5 130617878 missense probably damaging 1.00
ANU22:Caln1 UTSW 5 130669551 missense probably damaging 1.00
R0346:Caln1 UTSW 5 130822921 missense possibly damaging 0.83
R2180:Caln1 UTSW 5 130839408 makesense probably null
R2352:Caln1 UTSW 5 130506152 nonsense probably null
R7114:Caln1 UTSW 5 130839283 missense possibly damaging 0.93
R7159:Caln1 UTSW 5 130822997 missense probably benign 0.20
R7355:Caln1 UTSW 5 130414891 missense probably benign
R7611:Caln1 UTSW 5 130506077 missense probably damaging 0.99
Z1177:Caln1 UTSW 5 130839314 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTCTACCATTGTCCTGTGTAAAC -3'
(R):5'- ATCACAGGCTTTCAGACCCC -3'

Sequencing Primer
(F):5'- CCATTGTCCTGTGTAAACATGGAAGG -3'
(R):5'- GGCTTTCAGACCCCACCCC -3'
Posted On2016-10-05