Incidental Mutation 'R5673:Gm14226'
ID442708
Institutional Source Beutler Lab
Gene Symbol Gm14226
Ensembl Gene ENSMUSG00000084897
Gene Namepredicted gene 14226
Synonyms
MMRRC Submission 043175-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.143) question?
Stock #R5673 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location155018266-155027104 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 155024922 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 266 (S266R)
Ref Sequence ENSEMBL: ENSMUSP00000122157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029123] [ENSMUST00000109697] [ENSMUST00000130870] [ENSMUST00000137333] [ENSMUST00000148402]
Predicted Effect probably benign
Transcript: ENSMUST00000029123
SMART Domains Protein: ENSMUSP00000029123
Gene: ENSMUSG00000027596

DomainStartEndE-ValueType
Agouti 6 127 3.98e-69 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109697
SMART Domains Protein: ENSMUSP00000105319
Gene: ENSMUSG00000027596

DomainStartEndE-ValueType
Agouti 6 127 3.98e-69 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000130870
AA Change: S266R

PolyPhen 2 Score 0.812 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000122157
Gene: ENSMUSG00000084897
AA Change: S266R

DomainStartEndE-ValueType
Pfam:TLV_coat 14 627 1.4e-139 PFAM
low complexity region 649 662 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132342
Predicted Effect probably benign
Transcript: ENSMUST00000137333
SMART Domains Protein: ENSMUSP00000122261
Gene: ENSMUSG00000027596

DomainStartEndE-ValueType
Agouti 6 70 2.53e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148402
SMART Domains Protein: ENSMUSP00000121072
Gene: ENSMUSG00000027596

DomainStartEndE-ValueType
Agouti 6 75 2.32e-6 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik C T 6: 149,327,993 Q846* probably null Het
Abhd18 T A 3: 40,923,451 M94K probably damaging Het
Adam2 A G 14: 66,069,232 Y103H probably benign Het
Adamts17 T C 7: 67,041,807 C580R probably damaging Het
Aqp5 G A 15: 99,594,165 V98I probably benign Het
Brd2 A G 17: 34,112,607 probably benign Het
Cd177 T C 7: 24,750,362 N566S probably damaging Het
Cdh23 C T 10: 60,307,857 D2992N probably damaging Het
Cfap69 T C 5: 5,596,027 T140A possibly damaging Het
Cfi A G 3: 129,855,009 I181V probably benign Het
Cnksr1 A G 4: 134,235,188 L133P probably damaging Het
Col1a2 C T 6: 4,539,622 L1297F unknown Het
Crot T C 5: 8,988,131 N132S probably benign Het
Dnah3 T A 7: 119,951,589 Q3169L possibly damaging Het
Dnah8 T A 17: 30,803,261 M3945K probably damaging Het
Fam186a A C 15: 99,941,747 H2205Q possibly damaging Het
Fam204a T C 19: 60,199,983 K216E probably damaging Het
Far2 A T 6: 148,146,104 S94C possibly damaging Het
Gpr137 A G 19: 6,939,098 F276L probably damaging Het
Lhx3 T C 2: 26,202,994 Y148C probably damaging Het
Lrfn2 T C 17: 49,096,597 S583P probably benign Het
Lrrc40 A G 3: 158,048,398 probably null Het
Mast4 A T 13: 102,794,072 I224N probably damaging Het
Meis1 T C 11: 19,012,812 K161E probably damaging Het
Mptx2 G A 1: 173,274,847 L92F probably benign Het
Mrgprb2 A T 7: 48,552,373 F201L probably benign Het
Mroh1 T A 15: 76,430,181 L686Q probably damaging Het
Mybbp1a G A 11: 72,444,925 V421I probably benign Het
Nadk G A 4: 155,585,185 V143I possibly damaging Het
Nell1 A T 7: 50,228,846 T272S probably damaging Het
Npnt A T 3: 132,917,497 C94S probably damaging Het
Olfml2b T A 1: 170,682,129 V682E probably damaging Het
Pacs2 G A 12: 113,068,998 V655M probably damaging Het
Pcdha1 A C 18: 36,930,673 N130T probably damaging Het
Rnf145 G A 11: 44,531,293 V68M possibly damaging Het
Sh3pxd2a A G 19: 47,268,666 S566P probably damaging Het
Sirpa T G 2: 129,630,102 V483G probably damaging Het
Sox5 T C 6: 144,116,480 R149G probably damaging Het
Tbc1d4 A G 14: 101,455,008 S1007P probably damaging Het
Tnfrsf8 A G 4: 145,285,335 F317L probably benign Het
Ttn T C 2: 76,717,045 K32219R probably damaging Het
Vmn1r170 A T 7: 23,606,205 T11S possibly damaging Het
Vmn2r65 G T 7: 84,947,407 L147I probably benign Het
Vmn2r77 C T 7: 86,812,006 H847Y probably benign Het
Other mutations in Gm14226
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Gm14226 APN 2 155025158 missense probably damaging 1.00
IGL02852:Gm14226 APN 2 155024921 missense possibly damaging 0.91
R0279:Gm14226 UTSW 2 155025452 missense possibly damaging 0.82
R1393:Gm14226 UTSW 2 155024191 missense probably damaging 1.00
R1740:Gm14226 UTSW 2 155024931 intron probably benign
R1758:Gm14226 UTSW 2 155025458 missense probably damaging 1.00
R1816:Gm14226 UTSW 2 155025629 missense probably damaging 1.00
R1837:Gm14226 UTSW 2 155025010 missense probably benign 0.31
R1951:Gm14226 UTSW 2 155024335 missense possibly damaging 0.92
R4485:Gm14226 UTSW 2 155025271 missense probably benign 0.18
R4947:Gm14226 UTSW 2 155024959 missense probably benign 0.21
R5061:Gm14226 UTSW 2 155025186 missense probably benign 0.13
R5863:Gm14226 UTSW 2 155024291 missense probably benign 0.19
R6525:Gm14226 UTSW 2 155025083 missense possibly damaging 0.67
R6996:Gm14226 UTSW 2 155024437 missense probably benign 0.00
R7546:Gm14226 UTSW 2 155025211 missense probably damaging 0.96
R7593:Gm14226 UTSW 2 155024194 missense unknown
R7775:Gm14226 UTSW 2 155024710 missense possibly damaging 0.71
R7778:Gm14226 UTSW 2 155024710 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- CACCTATTGGAAACCCACTTCTG -3'
(R):5'- ACCTGACTTAAAGTGAGCCCAT -3'

Sequencing Primer
(F):5'- TCCTTTACTGACGCAGGAAG -3'
(R):5'- ACGACTGATCCGAATGTTGC -3'
Posted On2016-11-09