Incidental Mutation 'R5673:Vmn2r65'
ID442727
Institutional Source Beutler Lab
Gene Symbol Vmn2r65
Ensembl Gene ENSMUSG00000066372
Gene Namevomeronasal 2, receptor 65
SynonymsENSMUSG00000070600
MMRRC Submission 043175-MU
Accession Numbers

Genbank: NM_001105180; MGI: 3642776

Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R5673 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location84940169-84964009 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 84947407 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Isoleucine at position 147 (L147I)
Ref Sequence ENSEMBL: ENSMUSP00000036551 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044583]
Predicted Effect probably benign
Transcript: ENSMUST00000044583
AA Change: L147I

PolyPhen 2 Score 0.232 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000036551
Gene: ENSMUSG00000066372
AA Change: L147I

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 73 435 5.6e-41 PFAM
Pfam:NCD3G 501 553 1.3e-21 PFAM
Pfam:7tm_3 584 821 2.3e-53 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik C T 6: 149,327,993 Q846* probably null Het
Abhd18 T A 3: 40,923,451 M94K probably damaging Het
Adam2 A G 14: 66,069,232 Y103H probably benign Het
Adamts17 T C 7: 67,041,807 C580R probably damaging Het
Aqp5 G A 15: 99,594,165 V98I probably benign Het
Brd2 A G 17: 34,112,607 probably benign Het
Cd177 T C 7: 24,750,362 N566S probably damaging Het
Cdh23 C T 10: 60,307,857 D2992N probably damaging Het
Cfap69 T C 5: 5,596,027 T140A possibly damaging Het
Cfi A G 3: 129,855,009 I181V probably benign Het
Cnksr1 A G 4: 134,235,188 L133P probably damaging Het
Col1a2 C T 6: 4,539,622 L1297F unknown Het
Crot T C 5: 8,988,131 N132S probably benign Het
Dnah3 T A 7: 119,951,589 Q3169L possibly damaging Het
Dnah8 T A 17: 30,803,261 M3945K probably damaging Het
Fam186a A C 15: 99,941,747 H2205Q possibly damaging Het
Fam204a T C 19: 60,199,983 K216E probably damaging Het
Far2 A T 6: 148,146,104 S94C possibly damaging Het
Gm14226 T A 2: 155,024,922 S266R possibly damaging Het
Gpr137 A G 19: 6,939,098 F276L probably damaging Het
Lhx3 T C 2: 26,202,994 Y148C probably damaging Het
Lrfn2 T C 17: 49,096,597 S583P probably benign Het
Lrrc40 A G 3: 158,048,398 probably null Het
Mast4 A T 13: 102,794,072 I224N probably damaging Het
Meis1 T C 11: 19,012,812 K161E probably damaging Het
Mptx2 G A 1: 173,274,847 L92F probably benign Het
Mrgprb2 A T 7: 48,552,373 F201L probably benign Het
Mroh1 T A 15: 76,430,181 L686Q probably damaging Het
Mybbp1a G A 11: 72,444,925 V421I probably benign Het
Nadk G A 4: 155,585,185 V143I possibly damaging Het
Nell1 A T 7: 50,228,846 T272S probably damaging Het
Npnt A T 3: 132,917,497 C94S probably damaging Het
Olfml2b T A 1: 170,682,129 V682E probably damaging Het
Pacs2 G A 12: 113,068,998 V655M probably damaging Het
Pcdha1 A C 18: 36,930,673 N130T probably damaging Het
Rnf145 G A 11: 44,531,293 V68M possibly damaging Het
Sh3pxd2a A G 19: 47,268,666 S566P probably damaging Het
Sirpa T G 2: 129,630,102 V483G probably damaging Het
Sox5 T C 6: 144,116,480 R149G probably damaging Het
Tbc1d4 A G 14: 101,455,008 S1007P probably damaging Het
Tnfrsf8 A G 4: 145,285,335 F317L probably benign Het
Ttn T C 2: 76,717,045 K32219R probably damaging Het
Vmn1r170 A T 7: 23,606,205 T11S possibly damaging Het
Vmn2r77 C T 7: 86,812,006 H847Y probably benign Het
Other mutations in Vmn2r65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Vmn2r65 APN 7 84943553 missense probably damaging 0.99
IGL01104:Vmn2r65 APN 7 84940788 missense possibly damaging 0.93
IGL01154:Vmn2r65 APN 7 84943521 missense probably benign 0.00
IGL01453:Vmn2r65 APN 7 84940500 missense probably damaging 1.00
IGL01675:Vmn2r65 APN 7 84947379 missense probably benign 0.00
IGL01748:Vmn2r65 APN 7 84940299 missense probably damaging 1.00
IGL01997:Vmn2r65 APN 7 84940770 missense probably damaging 1.00
IGL02527:Vmn2r65 APN 7 84946516 missense possibly damaging 0.82
IGL02617:Vmn2r65 APN 7 84940341 missense probably damaging 1.00
IGL02676:Vmn2r65 APN 7 84940173 missense possibly damaging 0.86
IGL03084:Vmn2r65 APN 7 84943146 missense probably damaging 1.00
A4554:Vmn2r65 UTSW 7 84946583 missense probably damaging 0.96
PIT4651001:Vmn2r65 UTSW 7 84946253 missense probably benign 0.12
R0322:Vmn2r65 UTSW 7 84946548 missense probably benign 0.01
R0453:Vmn2r65 UTSW 7 84946234 missense probably benign 0.03
R0862:Vmn2r65 UTSW 7 84943645 missense probably benign 0.00
R1392:Vmn2r65 UTSW 7 84947416 missense probably benign 0.14
R1392:Vmn2r65 UTSW 7 84947416 missense probably benign 0.14
R1508:Vmn2r65 UTSW 7 84940678 missense probably benign 0.00
R1687:Vmn2r65 UTSW 7 84940818 missense probably benign 0.02
R1876:Vmn2r65 UTSW 7 84946297 missense probably damaging 1.00
R2136:Vmn2r65 UTSW 7 84943573 missense probably damaging 0.96
R2259:Vmn2r65 UTSW 7 84940911 missense possibly damaging 0.86
R2338:Vmn2r65 UTSW 7 84940843 missense possibly damaging 0.86
R2880:Vmn2r65 UTSW 7 84963886 missense probably damaging 1.00
R3410:Vmn2r65 UTSW 7 84946688 missense probably benign 0.00
R3411:Vmn2r65 UTSW 7 84946688 missense probably benign 0.00
R3770:Vmn2r65 UTSW 7 84940415 missense probably damaging 1.00
R3800:Vmn2r65 UTSW 7 84940530 missense possibly damaging 0.93
R3850:Vmn2r65 UTSW 7 84946651 missense probably benign 0.00
R4105:Vmn2r65 UTSW 7 84946483 missense probably benign 0.03
R4568:Vmn2r65 UTSW 7 84947469 missense probably damaging 1.00
R4677:Vmn2r65 UTSW 7 84963874 missense possibly damaging 0.55
R4768:Vmn2r65 UTSW 7 84947394 missense probably damaging 1.00
R4778:Vmn2r65 UTSW 7 84943593 missense possibly damaging 0.47
R5057:Vmn2r65 UTSW 7 84940611 missense probably damaging 1.00
R5279:Vmn2r65 UTSW 7 84940641 missense probably damaging 1.00
R5280:Vmn2r65 UTSW 7 84946334 missense probably damaging 0.99
R5394:Vmn2r65 UTSW 7 84946654 missense probably benign 0.04
R5487:Vmn2r65 UTSW 7 84946321 missense possibly damaging 0.76
R5580:Vmn2r65 UTSW 7 84947594 missense probably damaging 0.99
R5638:Vmn2r65 UTSW 7 84940839 missense probably damaging 1.00
R5688:Vmn2r65 UTSW 7 84940692 missense probably benign 0.00
R5935:Vmn2r65 UTSW 7 84943661 missense probably benign 0.00
R6354:Vmn2r65 UTSW 7 84940366 missense probably benign 0.35
R6372:Vmn2r65 UTSW 7 84940653 missense probably damaging 1.00
R6924:Vmn2r65 UTSW 7 84963990 missense probably benign 0.20
R7021:Vmn2r65 UTSW 7 84947379 missense probably benign 0.00
R7195:Vmn2r65 UTSW 7 84943139 critical splice donor site probably null
R7422:Vmn2r65 UTSW 7 84946361 missense probably damaging 0.99
R7654:Vmn2r65 UTSW 7 84941053 missense probably damaging 1.00
R7686:Vmn2r65 UTSW 7 84940536 missense probably damaging 0.99
R7691:Vmn2r65 UTSW 7 84943643 missense probably benign 0.30
R7798:Vmn2r65 UTSW 7 84946322 missense probably benign 0.00
R7798:Vmn2r65 UTSW 7 84946984 missense probably damaging 1.00
X0067:Vmn2r65 UTSW 7 84940905 missense probably benign 0.04
Z1088:Vmn2r65 UTSW 7 84943265 critical splice acceptor site probably null
Z1177:Vmn2r65 UTSW 7 84941026 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GATGTCATGTATGTGCCAGAAAATG -3'
(R):5'- AACTCTAGTGATCTCTGTGTTCTG -3'

Sequencing Primer
(F):5'- ATGTGCCAGAAAATGATAATTTAAGC -3'
(R):5'- CCAGAAATATCCACCTGATTTTGGC -3'
Posted On2016-11-09